chimeric transcripts detection tool

Hi, I want to analyze RNAseq data for detecting Chimeric transcripts. Which tool would be best to use. I am aware of some from here Nature. Kindly help.

thanks.

rna-seq

• 1,681 views • link

updated 7.8 years ago by enxxx23

• written 7.8 years ago by amitpande74 •

I know, that there's STAR-Fusion. But I don't know how it compares to the other mentioned tools.

Cheer,

Michael

• 0 views • link

written 7.8 years ago by michael.ante

1 answer

FusionCatcher https://sourceforge.net/projects/fusioncatcher/

• 0 views • link

written 7.8 years ago by enxxx23

More posts like this

PLINK Clumping d-prime or r2?
written 5.2 years ago by Filago •

Hello, I want to work with the [Fuma tool][1] in order to analyze my gwas data. This tool has an integrated clumping step (for highly …
single- indexed sequenced as paired end
written 5.2 years ago by amitpande74 •

Hi, I recently got some chip-seq data to analyze. I noticed that 60% of the reads did not align to the human genome. After little …
RNAseq data analysis of pooled data
written 5.3 years ago by luffy •

Hello experts, Kindly request you share your thoughts and tutorials for RNAseq data analysis from Raw data (FASTQ files) to arrive at differentially expressed genes. …
control and test samples name of PRJEB12123
written 6.2 years ago by dpc

Hi there!!! I want to analyse already submitted nucleotide sequence data in European Nucleotide Archive (ENA) with project number PRJEB12123. There are total 257 runs. …
Suggestion needed for finding fusion transcripts
written 6.6 years ago by c_u

Hi, I have RNA-Seq data coming from human tissue samples, and I am interested in finding fusion transcripts specific to the disease case. There are …
grep DNA after a pattern
written 7.0 years ago by amitpande74 •

HI, I have DNA sequences like these : ![](https://i.ibb.co/g3Vrjbm/seq.png) and I want to keep all sequences after this pattern "ACTTAAGTGTATGTAAACTTCCGACTTCAACTG" beginning with "TA". I tried …
Identifying novel isoforms from RNAseq data
written 7.8 years ago by taiber8 •

Hi everyone, I'm relatively new to bioinformatics and I need some help. I have RNAseq data from a specific subset of cells from the mouse …
Mapping of De novo assembled transcripts to draft genome
written 9.3 years ago by Bioinfonext

I want to map de novo assembled transcript which is in full length (start codon to stop codon) to the draft genome and want to …
Tool: IgDiscover: Analyze antibody repertoires and discover new V germline genes
written 9.6 years ago by GP •

Dear All, We have developed a tool called IgDiscover that can analyze the antibody repertoires and discover new V germline genes from high-throughput sequencing reads. …
Next Generation Seq. studing material
written 11.3 years ago by arronar

Hi. Can somebody suggest here some articles/books for an in depth explanation (main idea, chemistry) of NGS techniques? I have found only [this][1] article on …