I have a file which looks like this:

    >orf_1 364-2160
    atggcaggagcccgtggtctttggcgtgcaacagggatgaaagatactgattttggtaaa
    cccattattgctattgcgaattcttttacacaatttgtaccagggcatgtccatttaaaa
     .....
    >orf_2 2453-5197
    atggataataaagccacccataaaaataatttaatcccacaggcccccccttcatctgct
    cctcatcaacagcgcctcacacctatgatggagcaatatatagaaatcaaagcagtgaat
    .....

and a script that is supposed to insert the file content into a table:

#!/usr/bin/perl

use strict;
use warnings;
use Bio::Index::Fasta;
use DBI; # The perl database module

my $NucleotideFasta     = $ARGV[0];
my $ProteinFasta    = $ARGV[1];

die "Give the name of existing nucleotide fasta file and a file name for protein translations to be saved." unless (defined($NucleotideFasta) && defined($ProteinFasta));

# Replace with your mysql details
my $database    = "my_database.db";     #Change accordingly

# Create a connection to the database
my $dbh = DBI->connect("DBI:SQLite:$database","","") or die "Could not connect to the database $database.\n";

my $table_orfs  = 'orfs';   #Change accordingly
# Insert genes, make sure to use the correct table names etc = same as when you created the database
my $sth_insert = $dbh->prepare("INSERT INTO $table_orfs (orf_name,sequence,length,protein) VALUES (?,?,?,?)");

#read in nucleotide sequences
my $seq_nucleotide  = Bio::SeqIO->new( -format => 'fasta' , -file => $NucleotideFasta);
my $seq_protein     = Bio::SeqIO->new( -format => 'fasta' , -file => ">$ProteinFasta");

while (my $seq = $seq_nucleotide->next_seq() ) {
    #save protein translations to a file
    my $protein=$seq->translate();
    $seq_protein->write_seq($protein);
    #prepare for database input
    my $orf_id = $seq->display_id();
    my $nucleotides = $seq->seq();
    my $aminoacids  = $protein->seq();
    my $length = length($aminoacids);
    #print "$orf_id $length\n$nucleotides\n$aminoacids\n";
    $sth_insert->execute($orf_id,$nucleotides,$length,$aminoacids);
}

$dbh->disconnect();

My question is now, how can I create the table before using the script and which command should I use to run the script?

I know how to create a table, but in order for the script to work properly, what names in the tables should I use? Is it like this:

create table orfs( orf_name TEXT, sequence TEXT, length REAL, aminoacids TEXT );

When I do this I get:

DBD::SQLite::db prepare failed: table orfs has no column named orf_name at Gene2SQLite.pl line 21.
Can't call method "execute" on an undefined value at Gene2SQLite.pl line 37, <GEN0> line 1

. Maybe I misunderstood the task or am I supposed to create other names for the table?