I guess what I want to do is take my mapped reads with annotations and visualize in geneious or IGV.
I mapped sequencing reads to a published chloroplast genome. A annotation file is available for the reference chloroplast genome. How can I annotate the bam file I created?
1 answer
The bam file is not meant to be annotated. It simply tells you where each read aligned to the genome, in terms of coordinates. It also provides some other mapping information.
Example bam record:
chr1:3101907-3101936 0 chr1 3101907 255 30M * 0 0 TGGGCTGGGGCACAGTCTTTGCTGTCTGGG * NH:i:1 HI:i:1 AS:i:29 nM:i:0
Depending on what your goal is, you can definitely take your bam file and annotation file, and get some useful information from them. If its RNA-seq data you can make a table of counts to quantify gene expression. Then you could do things like differential gene expression.
Oh okay. Basically what you want to do is create a coverage track, such as a bigwig or bedgraph.
I recommend you to use a tool like bamCoverage or bedtools genomecov. These will take your bam file as input and output either bigwig or bedgraph. I recommend bigwig (so try bamCoverage from deepTools). Then you can load the bigwig file into IGV and visualize the coverage relative to annotations.
I have several chloroplast genomes I want to compare. Mine will match more closely with one of the other two. I'm not trying to look at coverage. So what I have now is reads mapped onto each reference (.bam files). and now I want to compare all of them together. Will those tools allow that? I wanted to just end up with an annotated version that I can view but I don't know how to get there from where I'm at.
Just to clarify - you aligned the same set of reads to various reference genomes?
What I mean by coverage is you will be able to view the signal of where the reads aligned relative to the genome annotation in IGV. So in IGV, you could load one of the chloroplast genomes, then see how well the coverage aligns with gene features, for example.
Log in to answer this question.