I have a genomic region that I would like to sequence using my MiSeq, this region is approximately 600-900 bp long.
I have primers that can sequence both halves of this region separately. I plan to amplify both halves, sequence them using a 300 cycle nano kit, then piece them back together to get the entire 600-900 bp region sequence.
The issues I am facing are:
1) How to clean up the Illumina Adapter Overhang sequences:
Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus specific forward primer sequence]
Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus specific reverse primer sequence]
2) How to piece together the sequences using a k-mer based tool
Thank you for your feedback and advice!
•
written
by
laurenkleine18 •
1 answer
How to clean up the Illumina Adapter Overhang sequences
Use a program like bbduk.sh from BBMap suite.
How to piece together the sequences using a k-mer based tool
Don't think you need to do anything fancy. A simple multiple sequence alignment (after converting the reads to fasta) could do the trick. You may be able to use tadpole.sh from BBMap for assembly.
Even at a million reads per nano run you are going to have a ton of coverage. So you will likely need to normalize the data down before doing the assembly.
Log in to answer this question.
-
Primer removal in amplicon sequencing
written by sxf520 •
-
Too many unpaired forward reads found by Trimmomatic
written by SilhouetteQ •
-
Any command line tools that can design primers from a multiple sequence alignment?
written by O.rka
-
Trimmomatic - can`t find a path for to file
written by vvs.hazia •
-
Preparing 16S gene amplicon (metagenomic) sequencing data for submission to ENA
written by KQUB •
-
Trimmomatic 0.39 bash script error
written by diazjr.arturo •
-
Tool to combine two sequenced amplicons and align them to reference sequence
written by laurenkleine18 •
-
a confusion about pandaseq assembly
written by xioli2013 •
-
Is it necessary to increase annealing T during PCR when there are adaptors in primers?
written by liuyifan2014 •
-
Designing Primers For Cloning From Pure Fungal Cultures
written by H@rry •
Pardon me for asking but you are only sequencing one region from one sample? Can you not do this using old fashioned sanger seq? Or am I missing something.
Yes, we could use Sanger Sequencing; that is the method that is traditionally used to sequence this region of interest.
Our lab (industry) has a MiSeq already and all of the reagents. The MiSeq Nano Kit is only ~$300. Instead of sending our samples out to a third party lab, this option would be much more convenient for us to get results on our own time.
You might be able to do it 'old school' and put the assemblies together with Phrap and Consed (though these are not Kmer based tools): http://www.phrap.org/phredphrapconsed.html