Hi,
I am trying to remove human reads from my metagenomic sequences (skin samples).
I have used the command recommended in the bbmap documentation:
bbmap.sh minid=0.95 maxindel=3 bwr=0.16 bw=12 quickmatch fast minhits=2 path=/path/to/hg19masked/ qtrim=rl trimq=10 untrim -ea -Xmx100g in=reads.fq outu=clean.fq outm=human.fq threads=12
My input is Illumina HiSeq 4000 Paired-end, 2x150 bp reads, so I want to split paired-end reads back into separated fastq files .._r1 .._r2.
Is there a way to do this using BBTools?
Thanks in advance!
•
written
by
c.e.chong •
Thank you very much for your help!
How would I find out if the clean.fq file is interleaved?
Check if two adjacent read pairs always have the same read name. This is an example of an interleaved file from a HiSeq3000:
@HWI-ST-J00104_BSF_0515:8:1101:10003:10036#DMSO_rep2_S43794/1
GGAAGAAAGACAGTCTGTGGCCCTGCCTGGGGACCTACACTGTCTGCTGTAACAGGCTTTCCCTTCATCTCAAGAG
+
AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@HWI-ST-J00104_BSF_0515:8:1101:10003:10036#DMSO_rep2_S43794/2
GGTTGAAAAGTGGCCTCGGTGTTCCAGACCTACCTGGTTCACTTAGCTTTTTCCTCCTTTCCTTCCTTTTATACTC
+
AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJFJJJJJJJFJJJJJJJJJ
@HWI-ST-J00104_BSF_0515:8:1101:10003:10141#DMSO_rep2_S43794/1
GTGATTCTCTTCAAGGCCACTCCTAAACAACTGTTGAATCCTTGATCCAGGCACCAAGCCCAGAGGTCCCTATCAG
+
AAAFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ<FJJJJJJJJJJJJJFJJJJJJJJJJJ
@HWI-ST-J00104_BSF_0515:8:1101:10003:10141#DMSO_rep2_S43794/2
GTCTAGGAGGAAACCAGGCTGTTAACTCCTCAGCAAAGACAAAGGAGGAGTTGGGCGGGGGCAAGACTAACTCCTA
+
AAFFFJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJAJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
Sorry to necro this but is there a difference in using reformat.sh vs bbsplit.sh to do this operation?
can reformat.sh also be used to separate R1/R2 reads that are merged ?
Again sorry to necro this post, but is the correct way to work with paired end data to use in1= in2= and then have a single outu and outm , then run reformat.sh to get the paired unmapped reads when trying to remove human contaminants?
It's validating that reformat.sh is the approach that the library author recommends here:
Tool to separate human and mouse rna seq reads
Can reformat.sh also be used to merge the replicate file?
like-
reformat.sh in1=file1_R1.fastq in2=file1_R2.fastq in1=file2_R1.fastq in2=file2_R2.fastq out=merged_R1.fastq out2=merged_R2.fastq
where file1_R1.fastq and file1_R2.fastq are the paired-end reads from the first replicate, and file2_R1.fastq and file2_R2.fastq are the paired-end reads from the second replicate?
Is it the correct way to merge the replicate?
•
written
by
nasreenbano91 •
Log in to answer this question.
As shown your command is only using one read file (
in=). So unless that file is interleaved there is no chance thatout*=files will be interleaved. @ATPoint shows what an interleaved file should look like. Note: Your headers may look different but Read 1 and 2 from one clusters should be one after the other in the file.Sorry that was a mistake, I have actually used in=r1.fq in2= r2.fq!
Thanks!