I'm trying to derive translations from nucleotide alignments. I'm particularly concerned with insertions/deletions which change the reading frame. For insertions, I omit translating the added nucleotides. I'm looking for advice on deletion treatment. I can treat the frameshift as biologically relevant by re-reading a prior nucleotide to mimic ribosome slippage. Slippage occurs in my target organism at specific sites, but should not result from deletions. Alternatively, I can treat the deleted nucleotide as ambiguous specifically for the purpose of the translation. In both instances, the original nucleotide sequence will be unaltered. Currently, I use a slippage interpretation, which makes frameshift designation more consistent. I differentiate between frameshift mutations and translational frameshifts.
Example 1
aligned sequence: CGGCAACAACUCGAC-UACCAAUACAUAUAUA
sequence input for translation: CGGCAACAACUCGACCUACCAAUACAUAUAUA
translation: R Q Q L D L P I H I
Example 2
aligned sequence: CGGCAACAACUCGAC-UACCAAUACAUAUAUA
sequence input for translation: CGGCAACAACUCGACXUACCAAUACAUAUAUA
translation: R Q Q L D X P I H I
0 answers
No answers yet.
Log in to answer this question.