Dear All,
I have a VCF file containing 60 samples.
I want to calculate MAF for each variant with respect to 60 samples present in a VCF file.
Can anyone please tell me how to calculate MAF for you own population data?
Thank you In advance for your help
•
written
by
Sudhir Jadhao
You can add the AF and MAF via the BCFtools +fill-tags plugin.
See my answer, here, in particular part 4: A: How to use bcftools to calculate AF INFO field from AC and AN in VCF?
bcftools +fill-tags test.vcf
[W::bcf_hdr_check_sanity] PL should be declared as Number=G
5 135337248 . CT C . PASS END=135337249;HOMLEN=3;HOMSEQ=TTT;SVLEN=-1;SVTYPE=DEL;AC=1;AN=2;NS=1;AF=0.5;MAF=0.5;AC_Het=1;AC_Hom=0;AC_Hemi=0;HWE=1;ExcHet=1 GT:AD 0/1:205,118
5 135337259 . AG A . PASS END=135337260;HOMLEN=4;HOMSEQ=GGGG;SVLEN=-1;SVTYPE=DEL;AC=1;AN=2;NS=1;AF=0.5;MAF=0.5;AC_Het=1;AC_Hom=0;AC_Hemi=0;HWE=1;ExcHet=1 GT:AD 0/1:190,220
5 135337259 . A AG . PASS END=135337259;HOMLEN=5;HOMSEQ=GGGGG;SVLEN=1;SVTYPE=INS;AC=1;AN=2;NS=1;AF=0.5;MAF=0.5;AC_Het=1;AC_Hom=0;AC_Hemi=0;HWE=1;ExcHet=1 GT:AD 0/1:192,71
5 135337264 . GA G . PASS END=135337265;HOMLEN=1;HOMSEQ=A;SVLEN=-1;SVTYPE=DEL;AC=1;AN=2;NS=1;AF=0.5;MAF=0.5;AC_Het=1;AC_Hom=0;AC_Hemi=0;HWE=1;ExcHet=1 GT:AD 0/1:184,83
5 135337274 . A ATTATTGCATCAACTCCTCCGACATCTCTTCCCCTGCAAGAGTTCAGGCCCACAGGTTCTGGTGTGGGCTTGCTCAGCTGGAGGTAGCCTGAGGTGAGCTGGAG .PASS END=135337274;HOMLEN=23;HOMSEQ=TTATTGCATCAACTCCTCCGACA;SVLEN=103;SVTYPE=INS;AC=1;AN=2;NS=1;AF=0.5;MAF=0.5;AC_Het=1;AC_Hom=0;AC_Hemi=0;HWE=1;ExcHet=1 GT:AD 0/1:130,17
Kevin
Thank you, Kevin!!!
I think it will help
I trying to run bcftools but I got below error:
bcftools: plugins/fill-tags.c:432: process: Assertion `rec->n_allele < 8*sizeof(int)' failed. Aborted (core dumped)
Trying to solve the error. Once the error is solved I will get back to you!!
What is the source of your VCF? Did you install the plugin exactly as per A: How to use bcftools to calculate AF INFO field from AC and AN in VCF? ?
Thank again Kevin,
What is the source of your VCF? => The file created using below command( merging of multiple vcf):
java -jar ~/Tools/GenomeAnalysisTK-3.8-1-0-gf15c1c3ef/GenomeAnalysisTK.jar -T CombineVariants -R ~/Database2/HG19_UCSC/hg19/Sequence/Chromosomes/GATK_UCSC_HG19.fasta --variant input.list -o All_sample_merge_GATK.vcf -genotypeMergeOptions REQUIRE_UNIQUE
File head:1
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT sample4 sample6 sample7 sample10 sample14 sample15 sample18 sample19 sample21 sample22 sample23 sample24 sample29 sample32 sample33 sample34 sample35 sample37 sample39 sample42 sample43 sample46 sample49 sample51 sample53 sample54 sample55 sample57 sample58 sample60 sample63 sample65 sample67 sample74 sample75 sample77 sample81 sample85 sample86 sample89 sample91 sample93 sample99 sample101 sample104 sample105 sample108 sample109 sample114 sample118 sample119 sample120 sample121 sample12 sample25 sample27 sample40 sample56 sample62 sample66
chr1 10146 . AC A 365.28 VQSRTrancheBOTH99.90to100.00 AC=1;AF=0.5;AN=2;BaseQRankSum=-1.498;ClippingRankSum=-0.659;DP=29;FS=10;GQ_MEAN=9;MLEAC=1;MLEAF=0.5;MQ=33.66;MQ0=0;MQRankSum=0.3;NCC=0;NEGATIVE_TRAIN_SITE;PG=0,0,0;QD=17.39;ReadPosRankSum=-0.18;SOR=1.85;VQSLOD=-8.428;culprit=MQ;set=variant64GT:AD:DP:GQ:PL:PP ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. 0/1:2,19:21:9:393,0,9:393,0,9 ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:. ./.:.:.:.:.:.
Did you install the plugin exactly as per A: How to use bcftools to calculate AF INFO field from AC and AN in VCF? ? => Yes, I have followed exactly same step
•
written
by
Sudhir Jadhao
Your VCF already has the AF tag ? For the variant in your post, it is 0.5 (50%). With the AF, you can automatically infer the MAF.
Can you explain it in little details with respect to MAF?
Sure!
In pseudocode, for bi-allelic sites:
Rule 1:
If (AF < 0.5) then MAF = AF
Rule 2:
if (AF > 0.5) then MAF = 1.0 - AF
The minor allele may not always be the variant base in your VCF
The calculation you explained is with respect to all samples?
Means the "If (AF < 0.5) then MAF = AF" 0.5 MAF of that particular allele is with respect to all sample present in VCF?
Yes, these tags are with respect to all samples that have genotypes.
Samples with ./.:.:.:.:.:. are not included, because these are effectively NA (missing)
Thank you, Kevin, this answers my main question.!!
Log in to answer this question.
This thread may help you....!!
Thank you, Nitin!! Will try to calculate manually using the mentioned formula in the link