This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Converting .bowtie files to .sam

Hi all, I have a couple of .bowtie alignment files and I would like to convert them to .sam. Can anyone please suggest a way to do that? Thanks in advance!

chip-seq sequencing alignment bowtie sam
• 2,880 views • link
written by mmitra • mmitra

There is no formal format called .bowtie. Are you sure these are not already in .sam format? What does file yourfile.bowtie show? Are you able see anything by head yourfile.bowtie?

• 1 views • link
written by GenoMax GenoMax

OP probably means the default output of bowtie before it switched to SAM. There is this legacy script from an ancient samtools version that you can have a look at.

• 1 views • link
written by ATpoint ATpoint

Yes, it seems to be the default output of bowtie. I will check the legacy script.

• 1 views • link
written by mmitra • mmitra

Or simpel realign the stuff if you can and set output to SAM.

• 0 views • link
written by ATpoint ATpoint

When I used the file command, I got "ASCII text". Here are first two lines of the file (used head command):

K00208:8:1101:273.14:91.19#0/1  -   chr3    185872452   CTTACATCCTAAAGAAAAAAAAGTAAATGTAAGACAACATAATAAAAGTTA L[e[LLVLL`VLV[LL[VL`Lii``e`e[Leii`Le`eeieiieieV[[LL 0   43:T>C

K00208:8:1101:281.26:91.19#0/1  +   chr15   76280494    CCCACATAGACGACTGATATAGCATGCTAATTGATCTCCCCATTACTATAC `[`ee[eeL[`L`VLVeie`[[LLLLHV[iVeL`L[LLLHHVLVL`LLLVL 0   5:C>A,23:C>A
• 1 views • link
updated by GenoMax GenoMax • written by mmitra • mmitra

0 answers

No answers yet.

Log in to answer this question.

More posts like this