Extract SNP flanking Sequence based on locations from reference fasta file
I have a list of SNP location in a file.
Chromosome position
chr01 2387766
chr01 7894895
chr01 9090373
chr02 1103
chr02 15118
chr03 160115
chr03 17804
chr04 190961
chr04 19573921
chr04 20867534
Now I want to extract SNP sequence along with flanking sequence of 200 bases. Output example: ACGTTGTCTTCAAGCTAAAGGCTCGTGGAATGAATGCGGC[G/A]GATCTCGGAAAACTTGGAAGATCAACTACTTTGAAAAGT
Reference genome file is present as a refernceGenome.fasta. How do i go about it.
• 3,451 views
•
link
written
by
pramodkp97 •
0 answers
No answers yet.
Log in to answer this question.
duplicate of Get Flanking Sequence Given A List Of Positions
There they are finding SNP from human genome which is supported in ENSEMBLE & UCSC database but in my case the genome is not annnotated and it is locally present in a fasta file. So i feel in this case i need some other way to get the flanking sequence.
A: Get Flanking Sequence Given A List Of Positions