This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How To Fetch Exon Sequence From Genomic Coordinates

Hi Everyone :)

I have a list of genomic coordinates and want to get only exon sequence for them.

I can get the whole sequence (exon+intron) by Bedrolls getfasta but I want JUST exon sequences.

Thank you :)

rna-seq gene
• 3,848 views • link
updated by cmdcolin cmdcolin • written by BehMah • BehMah

If you're using R, you could use the biomart package

• 1 views • link
written by caggtaagtat caggtaagtat

Thanks caggtaagtat! There is no assemble/annotation for rat (rnor 4) in biomart. There is just rnor 6 available :(

• 1 views • link
written by BehMah • BehMah

Hi, could you tell me how you solved the last problem about the joining of multiple fasta exons? Thank you!

• 0 views • link
written by francesca.crudele3 • francesca.crudele3

Please explain what you mean.

• 0 views • link
written by ATpoint ATpoint

2 answers

Bedrolls sounds like some new kind of sushi roll :-D It is bedtools. Anyway, what you can do is 1) intersect your genomic coordinates with a GFF/GTF file that contains exonic coordinates. GFF files, depending on the organism you are working on, are available from GENCODE, NCBI etc. For this, first isolate exons from the GFF:

awk 'OFS="\t", $1 ~ /^#/ {print $0;next} {if ($3 == "exon") print $1, $4-1, $5}' in.gff3 | sort -k1,1 -k2,2n > exon.bed

Then intersect this exon file with your coordinates:

bedtools intersect -a your_file.bed -b exon.bed > intersection.bed

If you want the entire exon (even if one part of the exon does not overlap with your_file.bed), then add option -wb to the command.

Then proceed with getfasta.

• 1 views • link
written by ATpoint ATpoint

Thank you ATpoint. Sorry for Bedtools which was type error ;) I will give it a go. Just wondering if there there a way to get a single exon sequence (joint multiple exons) so I get only one sequence per each interval ? something like below: because each interval contain multiple exons. THANKS FOR YOUR REPLY :) 

                   chr1    110743176       110749172                   gaatctgggtgagcaaatgcttcctgtgaccaacagggtatagtagaagtgatgctatgtgacttccaaggctagattaggaaaggccgtgccacttccacctggtgttctagggatactcattctagaggcagccagctgccatgtaagacagccaaccaccctgagactgccatgctagggaggcgatatgtttgcagatgcttaggttgacagcttcagctgagcttccagccaacagccagtgtcaactgccagccacatgaacacagcatactgaacgtttagcccagctgagcttcagatgtttgcagcccgctgacatctgattgtagctgcataagagaccctaagcaagaactgttcaactgagccctt
• 1 views • link
written by BehMah • BehMah

Ignore my last comment. I sorted it out thank you ATpoint :)

• 1 views • link
written by BehMah • BehMah

The gffread which has special tools for extracting the sequence given a gff and a reference seq http://ccb.jhu.edu/software/stringtie/gff.shtml

• 0 views • link
written by cmdcolin cmdcolin

Log in to answer this question.

More posts like this