Biostar Beta. Not for public use.
Extract fasta sequences from a file using a list in another file.
0
Entering edit mode
15 months ago
EBP91 • 0

I have a question concerning the extraction of sequences from a fasta file (>7000 sequences) using a reference .txt file with sequence headers. I have been playing around and been looking all over the internet to find a solution for this problem, but surprisingly, nothing really matches what I want to do. So, I have two files:

1) a fasta file which looks like this:

>Zotu1

ACTGACAAAGCA

TGCACGTCATTTT

>Zotu2

ATGCATCAGCATA

TGACCCCCGTTTA

>Zotu10

CGTCGAAAAATTT

CGATACACCCTAT

>Zotu22

CGTACGTCCCCTT

CGATATAATATATA

2) a .txt file with a list of sequence names:

Zotu1

Zotu2

Now, I want to use the .txt file to select sequences from the .fasta file. I have two semi-solutions that do part of the job.

OPTION 1:

cat list.txt | awk '{gsub("_","\\_",$0);$0="(?s)^>"$0".*?(?=\\n(\\z|>))"}1' | pcregrep -oM -f - sequences.fas > newfile.fas

Problem: this function gives me the full sequences, but extracts too many sequences since everything that partially matches the strings in the .txt file will be selected. In this case, it means that also Zotu10 and Zotu22 are selected.

OPTION 2:

grep -A 1 -wFf list.txt sequences.fas > newfile2.fas

Problem: this function correctly selects only the sequences that completely match the strings in the .txt file, but does not return the full fasta sequences, but only the part of the sequence on the first line. An output thus looks like this:

>Zotu1

ACTGACAAAGCA

>Zotu2

ATGCATCAGCATA

I tried combining both solutions but that somehow did not end well. I would be much helped by an elegant solution for this problem, preferably using the codes I already obtained.

Many thanks!

ADD COMMENTlink
0
Entering edit mode

Please format your fasta sequences appropriately, using the formatting button. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

ADD REPLYlink
0
Entering edit mode

I just did that for the OP. But yes from next time he or she should do it. Thanks WouterDeCoster

ADD REPLYlink
0
Entering edit mode

Thanks! I adjusted it a bit. It should be fine now.

ADD REPLYlink
0
Entering edit mode

Did you try to google it/ tried any solution?

I copy pasted your title and the first link I got is this: Extract fasta sequences from a large file using a list of names

ADD REPLYlink
0
Entering edit mode

Yes, I have been entirely through that thread (and several others) before posting here.

ADD REPLYlink
0
Entering edit mode

You now have 4 solutions below.

Once you are done testing all of them you should upvote those that work and mark them as accepted. You can accept more than one answer as long as they all work.
Upvote|Bookmark|Accept

ADD REPLYlink
2
Entering edit mode
13 months ago
India

with seqtk:

 $ seqtk subseq test.fa test.txt 
>Zotu1
ACTGACAAAGCATGCACGTCATTTT
>Zotu2
ATGCATCAGCATATGACCCCCGTTTA

with grep:

$ grep -w -A 2 -f  test.txt test.fa --no-group-separator
>Zotu1
ACTGACAAAGCA
TGCACGTCATTTT
>Zotu2
ATGCATCAGCATA
TGACCCCCGTTTA

inputs:

$ cat test.fa 
>Zotu1
ACTGACAAAGCA
TGCACGTCATTTT
>Zotu2
ATGCATCAGCATA
TGACCCCCGTTTA
>Zotu10
CGTCGAAAAATTT
CGATACACCCTAT
>Zotu22
CGTACGTCCCCTT
CGATATAATATATA

$ cat test.txt
Zotu1
Zotu2
ADD COMMENTlink
0
Entering edit mode

Did the job! Thanks!

ADD REPLYlink
4
Entering edit mode
4 months ago
Joe 12k
United Kingdom

This has been asked a lot, so an existing solution will almost certainly match what you need to do.

You will usually need to linearise your fasta:

awk '/^>/ {printf("%s%s\t",(N>0?"\n":""),$0);N++;next;} {printf("%s",$0);} END {printf("\n");}' < myseqs.fasta > linear.fasta

then:

while read IDS ; do grep "\b$IDS\b" linear.fasta ; done < listofids.txt

You can use \b in the grep command to mark word boundaries so that Seq1 doesn't match Seq11 for example.

Then you can rewrap your sequences (partially) by using tr '\t' '\n'.

The code I use is below (using biopython though, so it is a more robust method).

ADD COMMENTlink
1
Entering edit mode
3 months ago
genomax 68k
United States

Step 1: Get faSomeRecords utility from Jim Kent at UCSC. http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/faSomeRecords (Linux link, OS X or source available).

Step 2: Make the file executable

$ chmod u+x faSomeRecords

Step 3: Run faSomeRecords

$ ./faSomeRecords
faSomeRecords - Extract multiple fa records
usage:
   faSomeRecords in.fa listFile out.fa

in.fa = Your sequence file

listfile = file with fasta headers/names (one per line)

out.fa = file to store the result

ADD COMMENTlink
1
Entering edit mode
4 months ago
Germany

Strange (or funny) the third time today I recommended seqkit.

$ seqkit grep -n -f list.txt sequences.fas > newfile2.fas

should do the job.

fin swimmer

ADD COMMENTlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.1