This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to plot heatmap for the matrix for the pairwise comparison of sequence similarity in R ?

I am working sequence alignment and I want to show the percentage of difference among all the pairs. I got a pairwise comparison table in CSV format from MEGA in the following format :

Table 1.

a                   
b   1               
c   2   5           
d   1   8   7       
e   3   9   6   6

As you can see the output table does not contain names for the columns. Ideally, columns should be a,b,c,d,e so that (a,a=0), (a,b=1),(a,c=2) and so on.

My initial thought is that it might be easier if I convert this table into the format like follow :

Table 2. 

    a   b   c   d   e
a   0   1   2   1   3
b   1   0   5   8   9
c   2   5   0   7   6
d   1   8   7   0   6
e   3   9   6   6   0

1) Is it possible to make heatmap without converting table 1 to table 2 in R ?

2) Since my table has 380 columns , how do I convert table 1 to table 2 in R ?

3) Are there any visualization tool better than heatmap to plot this kind of data in R ?

r r heatmap
• 7,401 views • link
updated by Chirag Parsania Chirag Parsania • written by lokraj2003 lokraj2003

1 answer

You can use corrplot from package corrplot to generate the matrix heatmap. You can use your Table 2 as input. However, it will show you one of the half of given matrix. as.matrix should work to convert Table 1 to Table 2 

corrplot::corrplot(as.matrix(dd) , is.corr = FALSE , type = "upper",diag = F,method = "color",tl.cex = 3,cl.cex = 1)

Rplot03

• 1 views • link
written by Chirag Parsania Chirag Parsania

Log in to answer this question.

More posts like this
  • How to plot heatmap for the matrix for the pairwise comparison of sequence similarity in python?
    written by ramsha • ramsha
    I am working on sequence alignment and I want to show the percentage of difference among all the pairs. I got a pairwise comparison table …
  • Metagenomic Data management
    written by MSRS MSRS
    I have taxonomic assignment data from the metagenomic sample. How to merge data as described below? The data > Name Group-1 Name Group-2 Name Group-3 …
  • Get distance matrix based on node tree
    written by Chvatil Chvatil
    Hi, I need some help getting a phylogenetic distance matrix. Here are two examples: Example one: tree=ete3.Tree('(((A,B),C),D);') print(tree) /-A /-| /-| \-B | | --| …
  • Data clustering / matching enteries
    written by bioinfobeginner • bioinfobeginner
    I have a file A 1 2 3 4 5 6 B 2 4 54 34 3 10 C 1 2 4 5 7 5 …
  • combine columns from multiple files
    written by bk11 • bk11
    I have more than 100 tab delimited files with seven different columns in each files. I was to get a single file with first and …
  • Getting Index of normal/Diseased samples in R
    written by David_emir David_emir
    Hello All, I have a data frame like as follows, > df A B C D E 1 1 2 3 4 5 2 4 …
  • Merging data coloum wise in R
    written by David_emir David_emir
    Hello All, I am using R to merge two different CSV file into one new file. both of them has got gene name (1st column) …
  • DESeq2 problem with resultsNames
    written by baffiak1902 • baffiak1902
    Hi, can somebody explain me, where I make mistakes? I have DESeq sample table: SampleName countf condition replicate 1 15_3A 15_3A_union_name.count A 3 2 15_3B …
  • searching reads with a certain sequence in fastq file
    written by sumithrasank75 sumithrasank75
    I have a file say master.fastq which looks like : ``` @M00990:202:000000000-ADM27:1:1101:21678:1536 2:N:0:291 CCTTTTACCGACCCGCTCTTTCTCTCCTACGCTTATTTCCGTCTACCCTTCTCTTCACTCGCTATTTCTATTCTTAAAACTATCTTAATGTTCTGCCTTTGCTCTTTTCTTTTTTCTATAACCTCTCTACAGCCAACTCACCCATCTCCTTCCCTGCTACGCTATTCCTCTGTTAGTTTTTCTTCATCATACTTTTCTCATCTCACACTACCTTTGCACTTCTTCCTTTCCACGTCCCCTTTCTCCTACC + -----,,6;6,@+8++6+,,,<C5@,,,,,,+8,,;,,<,,,,,,,;,,;,,,<C,,,;,,8,,8CC,C,,,5,C,,,,99,+,+4,,,3,,9,,6,@<,,,,,,,9,,,,,,,4),,0**,,5),,5**,)59*0),,*)5,)))*,9,3,0++))5D:)))))5;+;+0)*;+*6++++),******3**50,6,+++**,0*,,31)88*0*1*5*1)0*:*7>C;3,035:0)))8).*2**.*:) @M00990:202:000000000-ADM27:1:1101:22685:1539 2:N:0:291 CTTATCACCGACTCTCTCCTTCTCTTCCAAGTTTATTTCCGACTCCCCTTATCTTCACTTGCTATTTCTATTCTTAAAACTATCTCGACCTTTCACCTTTCCCTCTTTCCTTCTTTTCTCTCCTTCTACACTCCCACCCACTCTTACTTCTTTCTTGTCACCGTTTCCATATTATACTTTCTTCTCTTACATAATTTTCTTCCTGCAAACTATTTAAGCAATCTCTTTCTTTCACCCCTTTTATCTCGCC + -----,,<;67@+B,,6,,,,;C5@,,,,,66<,,6,,<,,,66,,;,66,,;;C,,,;,4<,,<CC6C,;,,,;,,6,:,6?A9=,,+++2,5,,,9<?D,,,,,:C?,@,@,,5,?*3*,9**,,0**,*)93))4+))19*0**,,52,56+**5*03*)3)))42+2***5*+=3+,*4*2****,**2*,3,+++*0,50,,**5*****0****)5)***0**,,***3*)0)))3***0*))) ``` I want only …
  • How to extract unique mapped results from Bowtie2 bam results?
    written by zhwjmch • zhwjmch
    How to extract unique mapped results from Bowtie2 bam results? I used `samtools view -bq 1 WG.bam > unique.bam` However, my results contain 54792 lines, …