align_and_estimate_abundance.pl (rsem-parse-alignments: /lib64/libz.so.1: version `ZLIB_1.2.3.3' not found (required by rsem-parse-alignments))
Hi
I am trying to estimate transcript abundance from a transcriptome generated from paired-end RNA-seq data using Trinity (using trinityrnaseq-2.2.0).
Trinity.fasta (head)
>TRINITY_DN143007_c0_g1_i1 len=314 path=[632:0-108 633:109-132 634:133-313] [-1, 632, 633, 634, -2]
TTGGGACTTTTTATCTAAAATATTTGGTGGGAAAAGAGCATATAATTCACACGTCAAAAG
TTATTAGATCAGCTGTCTTACACAGGATAAAGTTTCACATTGCCCAAAAGATTAGGAGAT
GGAATCTTGTTTATTCTATGCCTTGGCCTATGAAATTGGATGTAGTTCACAATTGGGAGG
CACACTTGCCTAGCCCACCTCCGCATTTTGTTGGTTGACCTTTGACTGTTGTGTTTCTCA
TTTCTAAAGGCATATGAAGTTATTATCCTTCTTTTTGTGCAATTTTTTCTTCTTGCACTT
CTATGTCACTGTTG
>TRINITY_DN143046_c0_g1_i1 len=322 path=[300:0-321] [-1, 300, -2]
GTTTGGACGTGTATAATGAAGGAGAAAATATTTACTAATAGAGTGACTAATAAGGATTAA
TCTAAAAAGTTAAAAAATGGAAAAAAAAAAGAATTAGAGAAAAAAAGGCTAGTTGTGTGA
The command which i am using-
/opt/HPC_Applications/trinityrnaseq-2.2.0/util/align_and_estimate_abundance.pl --seqType fq --left qf_leaf_1.fastq --right qf_leaf_2.fastq --transcripts Trinity_clr.fasta --output_prefix RSEM_leaf --est_method RSEM --aln_method bowtie --trinity_mode --prep_reference --output_dir align
The error is as follows:
CMD: set -o pipefail && bowtie -q --all --best --strata -m 300 --chunkmbs 512 -X 800 -S -p 4 /home/nbri/nasreen/Trinity_clr.fasta.bowtie -1 /home/nbri/nasreen/qf_leaf_1.fastq -2 /home/nbri/nasreen/qf_leaf_2.fastq | samtools view -F 4 -S -b -o RSEM_leaf.bowtie.bam -
[samopen] SAM header is present: 228505 sequences.
# reads processed: 59479280
# reads with at least one reported alignment: 42603066 (71.63%)
# reads that failed to align: 16876214 (28.37%)
Reported 58309284 paired-end alignments to 1 output stream(s)
CMD: touch RSEM_leaf.bowtie.bam.ok
CMD: rsem-calculate-expression --paired-end -p 4 --no-bam-output --bam RSEM_leaf.bowtie.bam /home/nbri/nasreen/Trinity_clr.fasta.RSEM RSEM_leaf
rsem-parse-alignments /home/nbri/nasreen/Trinity_clr.fasta.RSEM RSEM_leaf.temp/RSEM_leaf RSEM_leaf.stat/RSEM_leaf b RSEM_leaf.bowtie.bam -t 3 -tag XM
rsem-parse-alignments: /lib64/libz.so.1: version `ZLIB_1.2.3.3' not found (required by rsem-parse-alignments)
"rsem-parse-alignments /home/nbri/nasreen/Trinity_clr.fasta.RSEM RSEM_leaf.temp/RSEM_leaf RSEM_leaf.stat/RSEM_leaf b RSEM_leaf.bowtie.bam -t 3 -tag XM" failed! Plase check if you provide correct parameters/options for the pipeline!
Error, cmd: rsem-calculate-expression --paired-end -p 4 --no-bam-output --bam RSEM_leaf.bowtie.bam /home/nbri/nasreen/Trinity_clr.fasta.RSEM RSEM_leaf died with ret: 65280 at /opt/HPC_Applications/trinityrnaseq-2.2.0/util/align_and_estimate_abundance.pl line 743.
I would greatly appreciate any insight on what might be going wrong.
Thanks
Nasreen
• 5,348 views
•
link
0 answers
No answers yet.
Log in to answer this question.
What type/flavor/version of Linux are you using?
i am using-
x86_64 x86_64 x86_64 GNU/Linux
CentOS release 6.5 (Final)
Cool. Can you open up a terminal session and try the following?
This should help install libz-related ("zlib") libraries. Once you have this installed, you might try re-running things and see if you get the same error.
i have tried but sudo command does not run in this linux system.
is there another command to install zlib-devel?
[sudo] password for nbri:
when i am giving password then below statements are coming-
nbri is not in the sudoers file. This incident will be reported.
If you need to install these libraries, you'll either need to get administrator access to your workstation (i.e., be added to the sudo'ers list by whomever administers your workstation), or you need to contact your technical support to install this package for you, as support will have that level of access.
Perhaps another option, which does not involve a local installation of Trinity: https://github.com/trinityrnaseq/trinityrnaseq/wiki/Accessing-Trinity-on-Publicly-Available-Compute-Resources
But if you need this installed locally, there's just no way around installing its library prerequisites.