This is a test version of Biostars. For the public version, visit https://www.biostars.org.
blastn errors following building of database

Wondering why I am getting following error, building the database as follows:

makeblastdb -in a.lines.fasta -input_type fasta -title a.lines -parse_seqids -dbtype nucl -out a.lines.fasta

After this running the following command:

blastn -db a.lines.fasta -query gapdh_mus.fa

Error:

Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring invalid residues at position(s): On line 1: 3-14, 25, 30, 33, 36, 38, 42, 44, 46, 48, 50, 54, 57, 62, 64, 68, 70, 73, 76-77, 86-87, 93, 98-99
Error: NCBI C++ Exception:
    "/builddir/build/BUILD/ncbi-blast-2.2.29+/c++/src/corelib/ncbiobj.cpp", line 926: Critical: ncbi::CObject::ThrowNullPointerException() - Attempt to access NULL pointer.

Thanks!

blast blastn makeblastdb
• 4,050 views • link
updated by Biostar Biostar • written by rbronste rbronste

Are there spaces in fasta headers?

• 1 views • link
written by GenoMax GenoMax

Yes one did have spaces, got rid of those however the second error still persists.

• 1 views • link
written by rbronste rbronste

Why are you using an ancient version of blast? Blast is now in v.2.7.1.

• 1 views • link
written by GenoMax GenoMax

I was actually just using the blast that was installed as a module on our computing cluster but yes it is quite aged. I guess I can install my own copy.

• 1 views • link
written by rbronste rbronste

Besides updating your blast version to something recent, could you re-build the db but this time activate the 'logging' (add -logfile <file> or so) and see what's reported?

• 1 views • link
written by lieven.sterck lieven.sterck 
Building a new DB, current time: 04/19/2018 16:29:25
New DB name:   a.lines.fasta
New DB title:  a.lines
Sequence type: Nucleotide
Keep Linkouts: T
Keep MBits: T
Maximum file size: 1000000000B
Adding sequences from FASTA; added 947804 sequences in 86.6696 seconds.
• 1 views • link
written by rbronste rbronste

right. the number of added sequences corresponds to the number of input sequences I assume?

otherwise looking fine.

Could you post an excerpt of the first lines of your input fasta file?

• 1 views • link
written by lieven.sterck lieven.sterck 
>flattened_line_0
GGGGGTTTTATAATTGTTGCTTTGACTCTGGCCCTGTGCAGCTCCTCCTCTGCTGCCCCGGTGGAGTCCTTTTACCCTCCAAGTTCTGCTGGAGCAGGCCCAGCAAGCCTCGCTCTGGTGGTTTTGGTCCCCTCTGGAAGAAGGGGGTGGGAGGGGCAGGCTGGTGGCTGGAGGAGAAAAGGGATGCGGGTGTGCTAGGGAGCAGGTGATGCAGAGATGGTGAAGTGGCATTGGGAGATGGAGTGTTTAAATGTTAAGGGGTGGGTAGAAAATGTACCAAGATATTTTGAGGGCTAAATTTGTTCTGGAAG
• 1 views • link
written by rbronste rbronste

give a few more ;) , let's say 10

nothing out of the ordinary at first sight though

• 1 views • link
written by lieven.sterck lieven.sterck

Actually when I pull one specific sequence out of the -db input and run a blast on that against gapdh it works however when its many added sequences in the -db input against the -query it gives me this error.

• 1 views • link
written by rbronste rbronste

you do understand that a.lines.fasta is your DB and gapdh is you input file, right? I'm thus not quite sure what you mean here.

• 1 views • link
written by lieven.sterck lieven.sterck

0 answers

No answers yet.

Log in to answer this question.

More posts like this