DNA Integrity in Whole Genome Sequencing
How important DNA integrity in the whole genome resequencing? If the early step of the library construction is DNA fragmentation (sonication), why NGS companies reject the sample that has degradation, or fragment size lower than 20kb?
next-gen
sequencing
genome
• 1,706 views
•
link
written
by
rizky_dsatrio •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Whole genome resequencing sample size for population genetics?
written by Dylan •Hi everyone, I'm a master's student, and I'm currently considering using whole genome resequencing to obtain SNP data for an endangered species for population genetics …
-
For people doing high molecular weight DNA sequencing library prep, do you see a steep drop off in …
written by Mark •Specifically, I'm wondering does anyone have trouble with magnetic bead clean up on high molecular weight DNA? I extracted some DNA using a High Molecular …
-
I have a question in Size-selection(SPRI) in ChIP-seq library preparation
written by oryzae51 •Actually, it is ChIPmentation protocol of "ChIPmentation CeMM v1.14 (September 2016)" but ChIP-seq library protocol of PerkinElmer, Nextflex have same step in SPRI size selection. …
-
Illumina technology output, 16S amplicon
written by Jelo •Hello everyone I am new to NGS and confusing about the sequence output If the fragment of DNA (e.g. GACTACACGGGTATCTAATCCCGTTCGCTCCCCTGGCTTTCGCGCCTCAG) will occur only once after …
-
Tool: ctDNAtools: an R package to work with ctDNA sequencing data
written by amjadDear community, I am pleased to share with you the R package I have developed for analysis of ctDNA sequencing data (ctDNAtools). https://github.com/alkodsi/ctDNAtools You can …
-
Library Prep for NGS
written by Sujata •The basic steps of a NGS library are as follows" 1.Sample extraction 2. DNA Fragmentation 3. End Repair and Adapter Ligation 4. Size Selection (varies …
-
MACS for chip-seq: difference between sonication size(bandwidth) and fragment size?
written by salamandraIn MACS algorithm article (https://genomebiology.biomedcentral.com/articles/10.1186/gb-2008-9-9-r137) for chip-seq says: "Given a sonication size (bandwidth) and a high-confidence fold-enrichment (mfold), MACS slides 2bandwidth windows across the genome …
-
Is the consistency of the NGS library size important?
written by mrs.hope •Hello everyone! I have a general question about the importance of keeping the library fragment size consistent between samples. All my libraries have fragments ranging …
-
Discrepancy between agarose gel and bioanalyzer after sonication for ChIP
written by augelloma •Hello, I was hoping someone could help me figure out the issue I am having with sonicated DNA for ChIP Seq. I ran an initial …
-
Forum: Quantifying ChIP-seq data: a spiking method providing an internal reference for sample-to-sa…
written by Sukhi SinghA nice paper about spiking method with respect to ChIP-Seq. Idea is to spike-in a foreign DNA (2.5%) of total ChiP'ed material, after sonication and …
I believe companies do not "reject", they probably warn the client the quality of sequencing and downstream analyses may be negatively affected. If the client then chooses to proceed, companies will proceed.
Dear h.mon
Thank you for your comment. How do you think about the downstream analysis that may be affected by low integrity DNA? If sonication step produces fragmented (small-size) DNA, why low integrity DNA can affect the sequencing quality or downstream analysis?
Regards