How can I demultiplex two Library preps(Single Index and Dual Index) ?
4 samples were used to build two different libraries Dual Index and Single Index. We mixed both libraries and added all the 8 samples to both lanes of an S2 flowcell.
Now we have the BCL files from this run and the problem we are facing is how to extract the 8 samples given that we have 3 adapters and 12 barcodes.
The first library has a single adapter and two indexes per sample. The second library has two adapters and one index per sample.
The first question here is if we can combine this two libraries into one SampleSheet or we should do it using two SampleSheets with bcl2fastq.
Here is part of our RunInfo
<Reads>
<Read Number="1" NumCycles="151" IsIndexedRead="N"/>
<Read Number="2" NumCycles="8" IsIndexedRead="Y"/>
<Read Number="3" NumCycles="151" IsIndexedRead="N"/>
</Reads>
<FlowcellLayout LaneCount="2" SurfaceCount="2" SwathCount="4" TileCount="88" FlowcellSide="2">
This SampleSheet should help to clarify what we are trying to achieve here:
[Settings]
Adapter CTGTCTCTTATACACATCT
Adapter2 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead3 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Thanks,
1 answer
I create a separate SampleSheet for each type of index. If 4 of the samples have two indexes, then I will put those four samples into their own SampleSheet. I'll put the remaining 4 samples that have one index into their own SampleSheet as well.
Log in to answer this question.
-
bcl-convert demux of flowcell with mixed index lengths
written by rustykb •
-
RunInfo.xml FlowcellLayout section meaning of FlowcellSide
written by b10hazard •
-
"Unrecognized data type(Cbcl)" when demultiplexing with Picard
written by RNG_Daemon •
-
Demultiplexing reads from three libraries (non, single and dual indices)
written by almogangel •
-
bcl2fastq --use-bases-mask error for dual index reads
written by Apex92 •
-
Issue with Demultiplex dual indexed Illumina reads using bcl2fastq, for beginners.
written by salvatore.digiorgio •
-
bcl2fastq2: how to correctly use the --use-bases-mask for different sequencing methods by Illumina ?
written by 乙
-
bcl2fastq report the whole sequences without trimming index and adaptor
written by sckinta
-
bcl2fastq v2.19.1.403 : error during demultimpexing single and dual index reads
written by sourav.por •
-
Converting to fastq and demultiplexing Illumina Hiseq4000 data using bcl2fastq
written by rubic
Are these regular Illumina indexes? According to the RunInfo.xml you have sequenced only one index read.
As far as I am aware, yes ? . Should it look something like this :
<read number="1" numcycles="151" isindexedread="N"/> <read number="2" numcycles="8" isindexedread="Y"/> <read number="3" numcycles="151" isindexedread="N"/> <read number="4" numcycles="8" isindexedread="Y"/>
?
Actually it should look like this.
Order of reads in Illumina tech is
Read 1 --> Index 1 --> Index 2 --> Read 2.I was worried that you did not sequence the second index becuase the example in main post is for single index reads.
Could it be that this was the XML for one of the library preps and not both (i.e. the single index prep)?
RunInfo.xmlis for the entire flowcell. If the second index read has not been sequenced then that is bad news. This run would need to be repeated to get those samples which have 2 indexes.Thanks for the clarification.
If we had something like this :
IsIndexedRead=N Y N
NumCycles=151 8 151
Number=1 2 3
This indicates that the RunInfo.xml was correct ??
Thanks,
That file is for a
paired-end single indexrun. Only the first index was sequenced. If you need first and second index to distinguish between samples that have 2 indexes then there is no option but to repeat the run.If this is an error on sequence provider's part then they should do the re-run at no cost to you.