Can any one tell me, what these lower case bases mean in assembled sequences (contigs.fa) obtained from velvet assembler.
For example:
>NODE_6732_length_139_cov_108.179855 AAGAGACTACATCTGATAAAGCAGATGCAATATGTTTCTATTTTGCTTGGTTTACAAGAT TTGCCGTAAAATTCCCATCAACTTCAGCACTTGGAAAGCAGTATGACAAGGTTAGGGAAA CTTATCTAAAATTCTATCAAAAATCATCAAAAata
I am working with Illumina single end (SE) reads and command which I used was as follows:
./velveth out_dir_velveth 17 -short -fastq input.fq
./velvetg out_dir_velveth -exp_cov auto -cov_cutoff auto -unused_reads yes -clean yes
Best,
•
written
by
Tm
1 answer
Hello,
In velvet, the lower-case bases define regions that have lower coverage. One would assume that high/low coverage is defined by the -cov_cutoff command-line parameter.
To add further for anyone else arriving here from a search engine for possibly related issue, 'N' bases represent gaps in the contigs, with the number of N bases in sequence representing the estimated size of the gap.
Kevin
Log in to answer this question.
-
Issues building indexed .bam files with SAMtools
written by lleipnitz •
-
Velvet - ins_length auto
written by Kenny •
-
Velvetg not producing output files
written by Pryce Michener •
-
Tutorial: InsideDNA: Benchmarking seven most popular genome assemblers
written by shilparaopradeep •
-
Different Problems with Velvet
written by stu111392 •
-
Velvetg error coverage=0
written by blanca •
-
De novo assembly for virus genome with Velvet.
written by Peter •
-
Metavelvet fails at Scaffolding stage
written by jamesT •
-
How To Set -Max_Coverage In Velvetg
written by rwn
-
Velvet: Retain Read Names In Afg File
written by Lee Katz
