This is a test version of Biostars. For the public version, visit https://www.biostars.org.
My output of variant calling is different by samtools and platypus

samtools command

samtools mpileup -u -f /usr/lib/cgi-bin/GenomaticMYELOID/ReferenceGenome/hg19/hg19.fa /home/anopperl6/Exomesoft/bam/sample_sort.bam | bcftools call -vmO z -o - > outputstudy.vcf.gz

Platypus command

python Platypus.py callVariants --bamFiles=/home/anopperl6/Exomesoft/bam/sample_sort.bam --output=/home/anopperl6/Exomesoft/bam/sample_sort.vcf --refFile=/usr/lib/cgi-bin/GenomaticMYELOID/ReferenceGenome/hg19/hg19.fa --logFileName=log_platypus --nCPU=4 --minFlank=0 --filterDuplicates=0 --maxVariants=20

variant calling snp software error samtools
• 3,397 views • link
written by Anop Singh Ranawat • Anop Singh Ranawat

I don't think this is a software error. This is exactly as expected. It would be a miracle if two variant calling tools presumably using a different algorithm produce exactly the same result.

• 0 views • link
written by WouterDeCoster WouterDeCoster

platypus can call this variant : 

chr11   32417945    .   T   C   2962    alleleBias  BRF=0.0;FR=0.5000;HP=1;HapScore=1;MGOF=18;MMLQ=38;MQ=60.0;NF=0;NR=746;PP=2962;QD=20;SC=CAGGCACACGTCGCACATCCT;SbPval=1.0;Source=Platypus;TC=5671;TCF=0;TCR=5671;TR=746;WE=32417953;WS=32417886   GT:GL:GOF:GQ:NR:NV  1/0:-298.01,0.0,-297.19:18:99:5671:746

but samtools can't

why ?

• 0 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by Anop Singh Ranawat • Anop Singh Ranawat

the variant in platypus is already 'bad' anyway because platypus set the FILTER : alleleBias

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

thanks Pierre Lindenbaum and WouterDeCoster,

so what you mean by bad variant ? could you explain ?

GATK also call this variant.

chr11 32417945 0 T C 11998.81 LowVariantFreq BaseQRankSum=7.009;DP=4998;DS;Dels=0.00;FS=0.000;HRun=1;HaplotypeScore=309.8281;MQ=50;MQ0=0;MQRankSum=0.371;QD=2.40;ReadPosRankSum=-1.931;SB=-0.01 GT:AD:DP:GQ:PL:MQ:GQX:VF 0/1:4317,669:4998:99:11999,0,159236:50:99:0.134

• 0 views • link
written by Anop Singh Ranawat • Anop Singh Ranawat

the variant was FILTERED (==use with caution) with alleleBias (7th column). I don't know the platypus fields but it should be declared in the VCF header...

##FILTER=<ID=alleleBias,Description="????">

Same for your second example: its a FILTERED with LowVariantFreq

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

thanks Pierre Lindenbaum,

i have one problem regarding above discussion , i have been finding somatic variant(AML) with single bam file. but alleleBias or LowVariantFreq variant can be present in finding somatic variant in vcf file.

so how to find somatic variant with single bam file by samtools ?

thanks in advance

• 0 views • link
written by Anop Singh Ranawat • Anop Singh Ranawat

Next generation sequencing data is full of error and variant callers, thus, rarely agree.

If you want to try to call this variant with SAMtools/BCFtools, try -c / --consensus-caller and -m, --multiallelic-caller separately with your BCFtools call command.

You can also try modifying

-p, --pval-threshold <float>    variant if P(ref|D)<FLOAT with -c [0.5]
• 0 views • link
written by Kevin Blighe Kevin Blighe

0 answers

No answers yet.

Log in to answer this question.

More posts like this