This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Extract out only subject line from local blast fasta file

Hi I would like to output all the subject line from the alignment with blastn. When I BLAST using NCBI webpage, I can download all the aligned sequences in FASTA form. With this I can later input into my code in R for further analysis. I want to do the same thing with my blastn in windows, where I can extract all the subject line (bolded) in a fasta form.

SSTP_scaffold0000007 length=368211 Length=368211

Score = 46.4 bits (50), Expect = 2e-006 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand=Plus/Minus

Query 1 TGTTTATGTGAACTTACtttttttG 25

           |||||||||||||||||||||||||

Sbjct 104524 TGTTTATGTGAACTTACTTTTTTTG 104500

blast genome r
• 2,356 views • link
updated by Sean Davis Sean Davis • written by le.hai • le.hai

Just for others for clarification: you have to do the filtering in Windows? Have you ever tried Cygwin (to use grep)?; linux virtual machine?; or just the basic (and free) EC2 instance from Amazon Web Services?

• 0 views • link
written by Kevin Blighe Kevin Blighe

Hi Kevin, thank you so much for your suggestion, I will look at those options, I initially wanted to do in Windows because I haven't got much experience with Linux and such, but I will make sure to give these a try.

• 0 views • link
written by le.hai • le.hai

1 answer

Do these help you?

• 0 views • link
written by Sean Davis Sean Davis

Hi Sean, thank you! I haven't thought about using blast through R, I initially thought of just editing the blastn output file using simple loop of recognizing the lines with sbjct, but the package seems pretty neat! I will give this a try and post my result later!

• 0 views • link
written by le.hai • le.hai

Log in to answer this question.

More posts like this