This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Blastn command line results -- bad alignments but high scores

I'm running blastn from the command line and keep getting weird results -- about half of the sequences have terrible alignments to the query, but have the same scores and E values as perfect matches. Using the -perc_identity option doesn't seem to change anything. I've tried changing just about everything except for the blast database.

If anyone has any advice I'd be very grateful.

ETA: This is using BLASTN 2.2.30+.

Command line used: blastn -db ../i20.fasta -query query1.txt -out test.txt -perc_identity 100

Example of results:

>HS3:591:C5VMVACXX:4:1101:10795:94073 1:N:0:CTAAGGTC
Length=100

 Score =   102 bits (55),  Expect = 2e-20
 Identities = 12/55 (22%), Gaps = 0/55 (0%)
 Strand=Plus/Plus

Query  1   GTATTTTTCAATTCTATTTACGCGTATAATATATCTTCGTCAACTATTGTGGAGT  55
           |    |   | |            || || | |                |    |
Sbjct  33  GGTGGTAAGATTCAATAAATACAATACAAGACACACATTATCTAATGGCTCTTTT  87

>HS3:591:C5VMVACXX:4:2316:8876:76137 1:N:0:CTAAGGTC
Length=100

 Score =   102 bits (55),  Expect = 2e-20
 Identities = 55/55 (100%), Gaps = 0/55 (0%)
 Strand=Plus/Plus

Query  1   GTATTTTTCAATTCTATTTACGCGTATAATATATCTTCGTCAACTATTGTGGAGT  55
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  41  GTATTTTTCAATTCTATTTACGCGTATAATATATCTTCGTCAACTATTGTGGAGT  95
blast
• 3,536 views • link
updated by Ram Ram • written by jennycade • jennycade

If you blast against very big contigs, then blast will return all the matches that fit your threshold. For instance your query could match many times against chromosome 1; so the score isn't for any particular match but for chromosome 1 in total.

Can you provide the blast version and the exact command line used and we can provide more help.

• 0 views • link
updated by Ram Ram • written by mark.ziemann mark.ziemann

Thanks for the reply. I added the version and command line I used to the post.

The database I'm searching is a bunch of sequencing reads, so they're not huge contigs. The thing that's really confusing me is that one sequence that only matches in 12 positions has the same score as another sequence one that matches all the way across.

• 0 views • link
written by jennycade • jennycade

Can you post the read sequences that were the queries in your example output? And the species of interest (I don't have your database). I wanted to recreate this locally.

• 0 views • link
written by pld pld

Thanks. The query is just the 55 bp sequence shown in the example—the sequencing reads are in the database. This is in an Arabidopsis mutant.

(I hope I'm being clear enough. I'm a newbie to bioinformatics!)

• 0 views • link
written by jennycade • jennycade

Can you pull the sequencing reads from the database?

• 0 views • link
written by pld pld

1 answer

Mystery solved—I'm looking at paired-end sequencing reads, and it turns out that the poorly-aligning sequences that showed up were mates of the good matches. I had concatenated the two read files together before I made the database, so blast was pulling out both of the mates in a pair when it gave me the results.

When I blast against a database made from just one of the read files it works fine.

• 0 views • link
written by jennycade • jennycade

Log in to answer this question.

More posts like this