This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Help with Illumnina Headers

Please give me a lecture on illumina headers....

I have been down loading NGS ChIP-Seq data to run comparative studies on our ChIp-Seq data. I have noticed that the headers on the data I have been down loading from NCBI is very different from our header. For example here is the header for a run from the united states sequence read archive (SRR) SRR1747943…. Notice that the header has the SRR number in it.

@SRR1747943.1.1 1 length=36
CTATTAAGTGACCTGAGTGGCAGGAAGAAGTAGCGC
+SRR1747943.1.1 1 length=36
HHHHHHHHHHHHHHHHHHHHGEGG############

Here is an example of the header from one of our runs. It has the standard header information including the sequencer identifier, etc.., etc..

@HWI-ST425:160:D1JFWACXX:3:1101:1247:1946 1:N:0:GCCAAN
NAAACTCCTTCATGAAGCTGATACAAGATGTCATGAATTGTNTTGCATCTGNNNATCTTCTGAGNNNNNNNNNNNAAAAGCATCACATTNNNNNNNNCCTT
+
.#4=DDFFFHHHHHJJJIIJJJJJJJJJIIIHHIJJJIIJJJ#1?FGHIHJI###00-BFGIGGG###########,,5;A>CD;@CDDC############

My question is was the header changed at SRR when the data was deposited, or was the header changed by the person who deposited the sequence? Is there some way I have find the original header for the SRR1747943 run?

sequence next-gen sequencing
• 1,729 views • link
updated by Charles Plessy Charles Plessy • written by landrjos • landrjos

2 answers

Not here to give you a "lecture" - It looks like the repository re-headers submissions anonymizing everything in the process.

• 0 views • link
written by Ram Ram

See the option -F | --origfmt of fastq-dump to get the original sequence names.

• 0 views • link
written by Charles Plessy Charles Plessy

Log in to answer this question.

More posts like this