This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Extracting Fasta sequences

Hello, I want to extract all the sequences which has 'tRNA-phe' present in it (along with the fasta head). And, I also want to extract the tRNA-phe sequences from multiple files, along with fasta head.

for eg, following fasta sequence contain tRNA-Phe, I want all the fasta head along with sequences with this key.

'' >JSAA01000083.1 Elizabethkingia anophelis strain nuh11 contig_83, whole genome shotgun sequence 1 genes found 1 tRNA-Phe c[5099,5172] 34 (gaa) ggtttcttagctcagttggtagagcaatggattgaaaatccatgtgtccc tggttcgattcctggagaaaccac ''

please help...

linux commands genomics
• 3,567 views • link
written by namgyalwangstuklama • namgyalwangstuklama

have you try anything?

• 0 views • link
written by shenwei356 shenwei356

I tried using grep command.

''grep -w tRNA-Phe file.txt ''

it gave me the output - 1 tRNA-Phe c[5099,5172] 34 (gaa) 1 tRNA-Phe c[10265,10338] 34 (gaa)

but not the sequences and fasta head.

• 0 views • link
written by namgyalwangstuklama • namgyalwangstuklama

There are lots of similar posts in this site, please search before asking.

seqkit grep --by-name --use-regexp --pattern tRNA-Phe  seqs.fa
• 0 views • link
written by shenwei356 shenwei356

what's the error? Try provide more information when giving feedback.

I guess you did not install the tool, haha

• 0 views • link
written by shenwei356 shenwei356

I already have seqkit,regexp installed .

can u inbox your mail id . I'll mail you the files

• 0 views • link
written by namgyalwangstuklama • namgyalwangstuklama

just paste the main error message here

• 0 views • link
written by shenwei356 shenwei356

grep -w will search for matches that represent / contain the entire word. Did you try a normal grep?

Also, if you want also the sequence afterwards, assuming the sequence is all in one line you can use grep -A1 which will return the "after context" of one line after the the one that matched your pattern.

Finally, why don't you install Bioawk and use that? It's super easy for these tasks.

• 0 views • link
written by Matteo Schiavinato Matteo Schiavinato

The first line contains the fasta head, the second one contains 'no. of genes found' and 3rd line contains the no. name of the gene,location and size. and 4th and 5th line contains the sequences.

''>LNOG01000023.1 Elizabethkingia anophelis strain 0422 contig_7, whole genome shotgun sequence

3 genes found

1 tRNA-Phe c[9122,9195] 34 (gaa)

ggtttcttagctcagttggtagagcaatggattgaaaatccatgtgtccc tggttcgattcctggagaaaccac

2 tRNA-Phe c[9762,9835] 34 (gaa)

ggtttcttagctcagttggtagagcaatggattgaaaatccatgtgtccc tggttcgattcctggagaaaccac

3 tRNA-Ser [118406,118494] 35 (gga)

agagaggtggccgagtggtcgaaggcgcacgcctggaaagtgtgtatact ccaaaagggtatcgagggttcgaatcccttcctctctgc ''

• 0 views • link
written by namgyalwangstuklama • namgyalwangstuklama

0 answers

No answers yet.

Log in to answer this question.

More posts like this