This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Consensus by aligning and extending the sequences

I am trying to align and extend some sequences to get a larger consensus sequence. Here is a toy example of my problem 

 ACTTACTGTAGTAGA
           GTA-AGATGCGATGAGGAGAT-GAGAAATG
                GATG--ATGAGGAGATAGAGAAATGATTATA
  ----------------------------------------------
 ACTTACTGTAGTAGAGATGCGATGAGGAGATAGAGAAATGATTATA

I tried with different MSA tools, but most of them are trying to align the sequences from the first position. I am wondering if I am not aware of any tool that will solve my problem.

fasta msa alignment
• 1,637 views • link
updated by h.mon h.mon • written by BDK_compbio BDK_compbio

1 answer

Try CAP3, or GAP4 / GAP5.

• 0 views • link
written by h.mon h.mon

Thanks !! I will try them

• 0 views • link
written by BDK_compbio BDK_compbio

Log in to answer this question.

More posts like this