This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Trimmomatic jar file

Hi everyone,

I am using supercomputer to analysise my RNA seq data and now I am in the step of adaptor removal. I am trying to use trimmomatic and I loaded the module using command: module load trimmomatic Then I used the command to trim the adaptors: java -jar trimmomatic-0.35.jar PE -phred33 input_forward.fq.gz input_reverse.fq.gz output_forward_paired.fq.gz output_forward_unpaired.fq.gz output_reverse_paired.fq.gz output_reverse_unpaired.fq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 Error: Unable to access jarfile trimmomatic-0.35.jar But I always get this error. I get to know now that I need to find the jar file and give its path on that argument. I loaded the module already and I have no idea how can I access that jar file on my system so that I can provide the path.

Please help. Thank you, Ambika

rna-seq trimmomatic jarfile

Can you see if you are able to locate trimmomatic by doing which trimmomatic after loading the module? Generally good sysadmins will create softlinks/shortcuts for jar files when creating modules so the users do not need to type full java commands. If you get a path for the command above then replace java -jar trimmomatic-0.35.jar in your command with just trimmomatic.

thank you, I got the path for that file now but now i am getting another error

java -jar /opt/asn/apps/trimmomatic_0.35/Trimmomatic-0.35/trimmomatic-0.35.jar PE -phred33 SL264821_1.fastq.gz SL264821_2.fastq.gz SL264821_1_paired.fastq.gz SL264821_1_unpaired.fastq.gz SL264 821_2_paired.fastq.gz SL264821_2_unpaired.fastq.gz ILLUMINACLIP:/opt/asn/apps/trimmomatic_0.35/Trimmomatic-0.35/adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

and my error is *TrimmomaticPE: Started with arguments: -phred33 SL264821_1.fastq.gz SL264821_2.fastq.gz SL264821_1_paired.fastq.gz SL264821_1_unpaired.fastq.gz SL264821_2_paired.fastq.gz SL264821_2_unpaired.fastq.gz ILLUMINACLIP:/opt/asn/apps/tri mmomatic_0.35/Trimmomatic-0.35/adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT' ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Exception in thread "main" java.util.zip.ZipException: Not in GZIP format at java.util.zip.GZIPInputStream.readHeader(GZIPInputStream.java:165) at java.util.zip.GZIPInputStream.<init>(GZIPInputStream.java:79) at java.util.zip.GZIPInputStream.<init>(GZIPInputStream.java:91) at org.usadellab.trimmomatic.util.ConcatGZIPInputStream$GZIPHelperInputStream.<init>(ConcatGZIPInputStream.java:143) at org.usadellab.trimmomatic.util.ConcatGZIPInputStream$GZIPHelperInputStream.<init>(ConcatGZIPInputStream.java:139) at org.usadellab.trimmomatic.util.ConcatGZIPInputStream.nextGzipInputStream(ConcatGZIPInputStream.java:37) at org.usadellab.trimmomatic.util.ConcatGZIPInputStream.<init>(ConcatGZIPInputStream.java:16) at org.usadellab.trimmomatic.fastq.FastqParser.parse(FastqParser.java:140) at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:264) at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:532) at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:62) * Can you please help me with this

Exception in thread "main" java.util.zip.ZipException: Not in GZIP format

This indicates that your input files are not in gzip format. How did you zip them?

I used gzip command gzip *.fastq

Dare I make a suggestion? You may want to try bbduk from BBMap suite to do the trimming. Easy to understand options and no installation required. See this thread for more information. Can use uncompressed or compressed files.

1 answer

I see that you are loading this program using the module load command. I think that module load only modifies your PATH environmental variable, but the java command that you are using may be looking for the JAR file in the CLASSPATH environmental variable.

I think that you will have to ask your system administrator for the exact location of the JAR file and/or ask him/her to modify also the CLASSPATH variable with the module load trimmomatic command

If you know the location of the JAR file, then you can specify it at runtime with, for example:

java -cp "trimmomatic-0.35.jar:/usr/library/trimmomatic/*"

The other solution is to download a copy of the JAR file to your home directory and execute it from there.

Thank you, I will ask the administrator for the exact location of jar file may be.

Log in to answer this question.