Hi shoujun.gu, should I run this in a for loop for multiple input file? I have over 100 fasta files to run... Can you please suggest?Thanks Mitra
Hello everybody, I have multiple fasta files from multiple samples I am trying to add the sample names in each sequence within each fasta file.
My one file looks like :
>M03691:51:000000000-BD94Y:1:1101:14841:1381 1:N:0:1
ACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAAGGCGGCCTGCTGGACGACAACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCCGGT
>M03691:51:000000000-BD94Y:1:1101:15960:1389 1:N:0:1
TACTGGGGTATCTAATCCTATTTGCTCCCCACGCTTTCGGGACTGAGCGTCAGTTATGCGCCAGATCGTCGCCTTCGCCACTGGTGTTCCTCCATATATCTACGCATTTCACCGCTACACATGGAATTCCACGATCCTCTCACACACTCTAGCTCTACGGTTTCCATGGCTTACCGAAGTTAAGCTTCGATCTTTCACCACAGACCCTTAGTGCCGCCTGCTCCCTCTTTACACCCAGT
>M03691:51:000000000-BD94Y:1:1101:15662:1415 1:N:0:1
ACTGGGTGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGGTGTAACGGTGGAATGTGTAGATATCGGGAAGAACACCAATGGCGAAGGCAGGTCTCTGGGCCGTTACTGACGCTGAGGAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCCCGTA
Now For example I want to add Sample1 in front of every sequence in this file. Keeping everything else as it is.
In this case I found one old post in Biostart which is very similar.. C: Renaming Entries In A Fasta File ..But it completely rename the header. I want to keep everything only add the sample name after >.
And addition I want to do this for a batch of files. So I assume I need to run some loop?
I am trying with this code...and obviously not successful. When I am in the folder where I have all the fasta files. I try to do this.
for f in *.fasta ; do
bname=`basename $f`
pref=${bname%%.fasta}
awk '/^>/{print ">bname" ++i next; next}{print}' < $f > ${pref}_new.fasta;
done
Can anybody please help me with this? Thanks,
Mitra
2 answers
I modified the script. You could try:
- save the code in a file named 'biostar.py' (or any other name)
- move all your fasta files into a new folder named 'newfolder' (or any other name)
- in shell (make sure python version is 3.5 or later), run: python3 biostar.py newfolder
- the output files are in the same folder with '_out' at the end of the original filename. You can modify it to what you want in the script.
import sys
import subprocess
import os
dir=sys.argv[1]
os.chdir(dir)
p=subprocess.run(["ls"], stdout=subprocess.PIPE)
filelist=p.stdout.strip().decode('ascii').split('\n')
for name in filelist:
output=name+'_out'
fa=[]
with open(name, 'r') as file:
for line in file:
if line[0]=='>':
line='>'+name+line[1:]
fa.append(line)
with open(output, 'w') as out:
out.writelines(fa)
hope the result is what you want
BBMap has a tool called rename.sh which I use for this purpose:
rename.sh in=file.fa prefix=sample1 out=renamed.fa addprefix
There's also a related tool, "muxbyname.sh", which is great for bulk operations (renaming sequences from many files based on their origin file and outputting them into a single file), but not quite applicable in this case.
Hi Brian, should I run this in a for loop for multiple input file? Can you please suggest?Thanks Mitra
Is there a correlation between existing file names and the sample prefix that could be leveraged to create a loop? Do your files still have the barcodes at the beginning of the reads?
yes there is correlation ...File names are same as sample name which I want to insert after > for each sequence in each multifasta file.
These files are already demultiplexed and adapter+barcode removed. Then I stitched them using fastq join (within qiime 1.1.9) and converted them to fasta from fastq using fastx-toolkit. So now ihave all multifasta files for each sample.
Log in to answer this question.
Are you doing this for the purpose of adding read groups to the samples?
I need to add Sample names to all sequences as later I want to concatenate all fasta files together and feed it for OTU picking in qiime. Thanks.
Qiime has accessory programs to do this sort of thing. Are you not following their workflow?
Please let me know if QIIME has any direct way to do this? I could't find any ..... There only it said I need to pass the file as labelled if I work with demultiplexed files. But not said how I can do this. So this is above as I was trying.