find genes name of a specific location
Hi. I'm trying to find the hits of an special pattern in human genome and then I want to know that the hits that has been find is belong to any special genes or not?
For doing that, I want use Bsgenome package for finding hits and Txdb package as annotation package for considering the genes.
how can I do that?
tnx all.
• 4,880 views
•
link
1 answer
Here is an example using the mouse genome and a random pattern:
# Load relevant packages
library(BSgenome.Mmusculus.UCSC.mm10)
library(TxDb.Mmusculus.UCSC.mm10.knownGene)
library(org.Mm.eg.db)
# Get occurence of motif in genome
motifRanges <- vmatchPattern("ACGGTAACGT", BSgenome.Mmusculus.UCSC.mm10)
# Get gene ranges
geneRanges <- genes(TxDb.Mmusculus.UCSC.mm10.knownGene)
# Annotate gene ranges with symbol
geneRanges$symbol <- mapIds(org.Mm.eg.db,
keys = geneRanges$gene_id,
column = "SYMBOL",
keytype = "ENTREZID",
multiVals = "first")
# Find overlaps between motif and gene ranges
hitsObject <- findOverlaps(motifRanges, geneRanges, type = "within")
# Extract the indexes of overlapping pattern and gene
motifHits <- queryHits(hitsObject)
geneHits <- subjectHits(hitsObject)
# Annotate motifs with overlapping gene_id and symbol
motifRanges$gene_id <- NA
motifRanges$symbol <- NA
motifRanges$gene_id[motifHits] <- geneRanges$gene_id[geneHits]
motifRanges$symbol[motifHits] <- geneRanges$symbol[geneHits]
• 0 views
•
link
Log in to answer this question.
What have you tried so far? Any error messages?
actually I don't know what should I do. I think I will have to granges variable that I can find overlaps of them.
It's not clear to me what you are doing, which data you have and what you exactly aim to achieve. Please elaborate.
I want to find the hits of the 'ACGGTAACGTACGTAGTCAT' in human genome using vmatchPattern function of bioString package. Suppose that one of the hits has been happened in chr5:124323-124344. I want to know that this hit is belong to any gene or not?
non-R solution:
Note: Script above looks for sequence "ccttctctgggccttgatttcccctcctgc" in chr 12 sequence (in fasta format) and intersects with gene list (in gtf format, downloaded from UCSC) on chr12. Seqkit output is in bed format.
output:
Download seqkit from http://bioinf.shenwei.me/seqkit/download/. Bedtools can be installed from synaptic/apt repositories in ubuntu.