bowtie2: user error or a bug?

I have a fastq file A.fastq

$ - cat A.fastq
@M04260:125:000000000-B9R94:1:1101:14837:1590 1:N:0:46
CGGCATTGACTGACAGCCTAGCATTTAAACGAGATTGTTTAAACAAAGATAAGG
+
111>1AF11BD1AA11AAG1EG1GHHFBBA0000FGFGHHDBDFFA000FD111
@M04260:125:000000000-B9R94:1:1101:17735:1640 1:N:0:46
TCTATGGATAGTTTACTGGCTTTAAATGGTCCAAGCTATTTTGCTAACATGGGA
+
1>AAA311FBBDGGBFG31FGGHFBBGB1GHHCFFFHFHHHHHGHBFGBGFEAB

And I have fastq file B.fastq

$ - cat B.fastq
@M04260:125:000000000-B9R94:1:1101:23356:9902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH

Two reads in A.fastq and One read in B.fastq. Tree total. And then ...

 $ - bowtie2 -x INDEX -U A.fastq,B.fastq > AB.sam
    2 reads; of these:
      2 (100.00%) were unpaired; of these:
        0 (0.00%) aligned 0 times
        2 (100.00%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
    100.00% overall alignment rate

That's not three. Why is this happening? It seems to ignore the rest of the unpaired files, even a third one. From the bowtie2 (version 2.3.2)help message, multiple files can be specified. What gives?

  <m1>, <m2>, <r> can be comma-separated lists (no whitespace) and can be
  specified many times.  E.g. '-U file1.fq,file2.fq -U file3.fq'.

bowtie2 multiple files unpaired

• 2,108 views • link

written 9.1 years ago by bitjunkie •

Try:

cat A.fastq B.fastq | bowtie2 -x INDEX -U - > AB.sam

bowtie2 -x INDEX -U A.fastq -U B.fastq > AB.sam

Anyway, it does indeed look like a bug.

• 0 views • link

written 9.1 years ago by h.mon

Tired the second one to the same effect. However, the first one did report the three reads. Interesting. Error in parameter parsing perhaps?

• 0 views • link

written 9.1 years ago by bitjunkie •

Same thing happens when I try to map two read pairs with

-1 p1_1.fastq,p2_1.fastq -2 p1_2.fastq,p2_2.fastq

1 reads; of these:
  1 (100.00%) were paired; of these:
    0 (0.00%) aligned concordantly 0 times
    1 (100.00%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    0 pairs aligned concordantly 0 times; of these:
      0 (0.00%) aligned discordantly 1 time
    ----
    0 pairs aligned 0 times concordantly or discordantly; of these:
      0 mates make up the pairs; of these:
        0 (0.00%) aligned 0 times
        0 (0.00%) aligned exactly 1 time
        0 (0.00%) aligned >1 tim

• 0 views • link

written 9.1 years ago by bitjunkie •

It looks like it always omits reporting the last read in second file from the sam file. So if you just have one in file B that is not reported.

$ more A.fq
@M04260:125:000000000-B9R94:1:1101:14837:1590 1:N:0:46
CGGCATTGACTGACAGCCTAGCATTTAAACGAGATTGTTTAAACAAAGATAAGG
+
111>1AF11BD1AA11AAG1EG1GHHFBBA0000FGFGHHDBDFFA000FD111
@M04260:125:000000000-B9R94:1:1101:17735:1640 1:N:0:46
TCTATGGATAGTTTACTGGCTTTAAATGGTCCAAGCTATTTTGCTAACATGGGA
+
1>AAA311FBBDGGBFG31FGGHFBBGB1GHHCFFFHFHHHHHGHBFGBGFEAB

$ more B.fq
@M04260:125:000000000-B9R94:1:1101:23356:9902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH
@M04260:125:000000000-B9R94:1:1101:21456:0902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH
@M04260:125:000000000-B9R94:1:1101:22456:0902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH
@M04260:125:000000000-B9R94:1:1101:24456:0902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH

$ cat A.fq B.fq | bowtie2 -x genome -U - > AB.sam
5 reads; of these:
  5 (100.00%) were unpaired; of these:
    5 (100.00%) aligned 0 times
    0 (0.00%) aligned exactly 1 time
    0 (0.00%) aligned >1 times
0.00% overall alignment rate

• 0 views • link

written 9.1 years ago by GenoMax

0 answers

No answers yet.