This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Lack of 5' UTR in genome?

Hello Biostars, I have been using iGV to visual my transcripts, genome, and reads. However, once I check a certain gene's sequence on a database (in this case Xenbase for Xenopus Laevis), it lacks a 5' UTR coding region. This is likely due to an incomplete genome and annotation on the database. However I find that when I look at my own reads and transcripts, there seems to be no possible 5' UTR region as the exons/coding regions begins immediately where the transcript is indicated. Is it possible that there is just no 5' UTR region on this particular gene or is there a different way to visualize it? I have aligned my reads against the genome that is retrieved from the database so I don't believe that there would be a 5' UTR region annotated but shouldn't I be able to visualize it through my reads/transcripts?

Image of my transcript (first one) compared to the known annotation, the ones below it.

gene alignment

1 answer

Make sure to use annotations that include both transcripts and coding sequences. Then you will see the UTRs. Your reads will, of course, correspond to transcripts and not coding sequences.

I opened up the Xenbase browser and visualized Xenopus laevis 9.2 genome with GenBank annotations. Every gene appeared to have UTRs you can even get them in text format:

>chr3L chr3L:118183459..118183512 (+ strand) class=five_prime_UTR length=54
GTGACATTGGCTACAAGGAGCTGCTCTGTGGATTTACCAGGGACTCAGAAGAAG

Ah I have exons in my annotation but not CDS specifically. But if you look at my gene of interest, abi2.S, this is the S version of a homeolog, on xenbase there is no annotated 5' UTR. I use the same annotation for my own RNA Seq purposes but what would be the best way to try to find the 5' UTR?

Here is the link of the specific sequence I'm looking at: http://gbrowse.xenbase.org/fgb2/gene_model_details/xl9_1?feature_id=851835

There is no 5' UTR annotated but when I look at my sequence output there is additional transcripts but on the opposite strand (positive instead of negative like this gene. Is it possible that this is where the potential UTR region is despite the opposing strands. They overlap completely regardless and there is an overhang on both ends for a potential 5' or more 3' UTR regions.

The first strand is on the positive strand. This is my personal annotation that I made using a program that finds novel transcripts based on a known reference genome. The second few strands are the known already Xenbase annotated sequences. They are opposing strands but have exons in the same area?

Log in to answer this question.