This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to create the taxonomy file for RDP Classifier?

The RDP classifier requires a custom taxid file if the user has to train the classifier with a custom database. I would greatly appreciate if anyone can share instructions on how to make such a file using the sequence annotations in the FASTA file. For reference, it looks something like this : 

0*Root*-1*0*rootrank
1*k__Archaea*0*1*domain
2*p__Crenarchaeota*1*2*phylum
3*c__Thermoprotei*2*3*class
4*o__Acidilobales*3*4*order
5*f__Acidilobaceae*4*5*family
6*g__Acidilobus*5*6*genus

Thanks

rdp classification
• 2,154 views • link
updated by gb gb • written by muraliadithya315 • muraliadithya315

I want the same, probaly need to make my own script. But sugestions of other people are welcome

• 0 views • link
written by gb gb

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • what is * in the NCBI Blosum and PAM matrices
    written by nobu.kim66 • nobu.kim66
    # Matrix made by matblas from blosum45.iij # * column uses minimum score # BLOSUM Clustered Scoring Matrix in 1/3 Bit Units # Blocks Database …
  • Get distance matrix based on node tree
    written by Chvatil Chvatil
    Hi, I need some help getting a phylogenetic distance matrix. Here are two examples: Example one: tree=ete3.Tree('(((A,B),C),D);') print(tree) /-A /-| /-| \-B | | --| …
  • Problem in using tablemaker for bam & gtf files
    written by Doofania • Doofania
    Hi, I had a bam file with me, I created the required .gtf using StringTie, but when I run tablemaker (https://github.com/leekgroup/tablemaker) on it, it produces …
  • Convert From Graphviz (Dot Language) to Newick format
    written by richard_95 • richard_95
    Hello, I'm working on gain/loss gene events and for that I'm using a tool that gives as an output a gene tree in Graphviz format …
  • nrow,ncol name,matrix name
    written by gizemtatar • gizemtatar
    My input; ```r seq1="GCATGCU" seq2="GATTACA" n=length(s1string) #seq1 m=length(s2string) #seq2 ``` This matrix ```r D <- matrix(0,nrow=m+1, ncol=n+1) ``` seq1 and seq2 length = 7 but …
  • searching reads with a certain sequence in fastq file
    written by sumithrasank75 sumithrasank75
    I have a file say master.fastq which looks like : ``` @M00990:202:000000000-ADM27:1:1101:21678:1536 2:N:0:291 CCTTTTACCGACCCGCTCTTTCTCTCCTACGCTTATTTCCGTCTACCCTTCTCTTCACTCGCTATTTCTATTCTTAAAACTATCTTAATGTTCTGCCTTTGCTCTTTTCTTTTTTCTATAACCTCTCTACAGCCAACTCACCCATCTCCTTCCCTGCTACGCTATTCCTCTGTTAGTTTTTCTTCATCATACTTTTCTCATCTCACACTACCTTTGCACTTCTTCCTTTCCACGTCCCCTTTCTCCTACC + -----,,6;6,@+8++6+,,,<C5@,,,,,,+8,,;,,<,,,,,,,;,,;,,,<C,,,;,,8,,8CC,C,,,5,C,,,,99,+,+4,,,3,,9,,6,@<,,,,,,,9,,,,,,,4),,0**,,5),,5**,)59*0),,*)5,)))*,9,3,0++))5D:)))))5;+;+0)*;+*6++++),******3**50,6,+++**,0*,,31)88*0*1*5*1)0*:*7>C;3,035:0)))8).*2**.*:) @M00990:202:000000000-ADM27:1:1101:22685:1539 2:N:0:291 CTTATCACCGACTCTCTCCTTCTCTTCCAAGTTTATTTCCGACTCCCCTTATCTTCACTTGCTATTTCTATTCTTAAAACTATCTCGACCTTTCACCTTTCCCTCTTTCCTTCTTTTCTCTCCTTCTACACTCCCACCCACTCTTACTTCTTTCTTGTCACCGTTTCCATATTATACTTTCTTCTCTTACATAATTTTCTTCCTGCAAACTATTTAAGCAATCTCTTTCTTTCACCCCTTTTATCTCGCC + -----,,<;67@+B,,6,,,,;C5@,,,,,66<,,6,,<,,,66,,;,66,,;;C,,,;,4<,,<CC6C,;,,,;,,6,:,6?A9=,,+++2,5,,,9<?D,,,,,:C?,@,@,,5,?*3*,9**,,0**,*)93))4+))19*0**,,52,56+**5*03*)3)))42+2***5*+=3+,*4*2****,**2*,3,+++*0,50,,**5*****0****)5)***0**,,***3*)0)))3***0*))) ``` I want only …
  • Help with HapTree reads input format
    written by phoenixice154 • phoenixice154
    Dear All, I am going to try HapTree to phase the SNP/MNP/InDel/Complex in my VCF, and want to give HapTree a try. But I really …
  • Can these fusion predictions by tophat be trusted
    written by Dataminer Dataminer
    Hi, I have got these results from tophat-fusion: ``` chr15-chr17 74317267 38506035 ff 1 13 1 7 43 33 10.000000 @ 13 26 38 51 …
  • What is the format of input test data in svmlight classifier? How to generate it?
    written by karimkhan.it • karimkhan.it
    I am using svm classifier [svmlight](http://svmlight.joachims.org/) In sample example that take input test file in this format: 4 qid:4 1:1 2:0 3:0 4:0.2 5:1 3 …
  • How To Generate A Motif Object Directly For A Count Matrix In Biopython
    written by cauyrd • cauyrd
    <p>If I have a variable in python like this:</p> <pre><code>pfm = {'A': [0, 1, 2, 3, 4, 5, 6, 7, 8, 9], 'C': [0, 1, …