Receiving an error when using blastn remotely within a loop. "service not found" "null_connector" "Cannot read header" "Unable to read data" and "Failed to flush"
I"m receiving the errors below when running this script. I don't know what the errors mean or how to fix them. Is it possible I was blocked from the blast server?
Script I'm running
for org in "Homo sapiens" "Mus musculus" ... ...
do
for gene in Acan ... ... ...
do
blastn -query geneFiles/$Gene -db refseq_genomic -out "outputfile" -evalue 0.00001 -outfmt 6 -entrez_query "${org}[Orgnanism] AND refseq[filter]" -remote
done
done
geneFiles/Acan (Example of one of the files I'm passing to the script
>NM_013227.3 Homo sapiens aggrecan (ACAN), transcript variant 2, mRNA
CACCTACCTCCCCGCCGCTCCAGAGGGGGCTCGCAGAGCTGAGGACGCGCGCAGCGCTGCTCAAGGTCTC
...
Errors (Repeats over and over)
Error: (308.5) [blastn] [blast4] Service not found
Error: (315.2) [blastn] CConn_Streambuf::CConn_Streambuf(): NULL connector: Unknown
Error: (802.5) [blastn] CObjectOStream: error at byte 93: stack is empty: write fault
Warning: (307.8) [blastn] [HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0] Cannot read header (Timeout)
Error: (301.23) [blastn] [CONN_Read(blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0)] Unable to read data: Timeout[30.000000]
Error: (315.8) [blastn] CConn_Streambuf::underflow(): CONN_Read() failed (blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0): Timeout
Warning: (301.21) [blastn] [CONN_Flush(blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0)] Failed to flush: Closed
Error: (315.9) [blastn] CConn_Streambuf::overflow(): CONN_Flush() failed (blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0): Closed
• 3,559 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Consider changing to a short/informative title for your post. Using an error message as is, is never informative.
What would you recommend, I don't know what else to post because all I know is that this error is happening
How about "Error(s) with remote blast".
Did you verify with one or two sequences that the searches were working before using the full scale double loop?
Are you behind a proxy/firewall? Are you using the latest blast+ executables? You should also limit remote blast calls to a certain number per unit time otherwise your IP may be blacklisted by NCBI.
I haven't had firewall problems with previous blast commands I've executed, but I'm not sure if I'm behind one.
I just downloaded blast+ last week so I am probably on the latest.
I put in a sleep command into my loop but I might already be blacklisted. Is there a way I can fix that?
If your IP is black listed (run a single search to see if it goes through to check) then wait a day or so until the block ages out. Put in a longer delay between your jobs/run smaller batches at one time.