Which tool was used to generate this mapping file?
Dear all,
I saw a mapping file with an extension of .map. The format of this file is shown below. It can be easily infered that Ithe first two lines are locus information. The third line is the sequence of this locus, and the following lines are aligned reads. But, what does the number at the end of each row (e.g., -16, -1) mean? Which tool was used to generate this mapping file?
Thank you very much!
>Chr1_78927_79037_ath-MIR165a_- 5'=50 3'=50
|5'end50bp | 79037bp 78927bp|3'end50bp
TTTGTGAATCTGCTAAGATCGATTATCATGAGGGTTAAGCTATTTCAGTTGAGGGGAATGTTGTCTGGATCGAGG
............................................................GTTGTCTGGATCGA -16
..........................................................TCGTTGTATGGATCGA -1
...............................................................GTTGTCTGGATCG -1
.............................................................GTTGTCGGATCGA 1
• 1,723 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Where did you see this file?
Honestly, the file was from my friend's friend. The reads are short RNA sequences mapped on MIR gene locus. The actual size of the reads are relatively longer. I just make an example there.
Best to ask your friend's friend then, he should know.
I'd suggest you ignore those files, and use a standardized format like sam. Otherwise, the results of the experiment will not be reproducible.
Thank you, Brian. I am re-doing mapping. I agree to start from beginning.