This is a test version of Biostars. For the public version, visit https://www.biostars.org.
error in fasta sequence extraction based on gene ID

My fasta file header is like this:

>MSTRG.8.1 gene=MSTRG.8

AATCGACCAGAACGTTGACGACTTCTTGAAGCTTATAGCCGATCTCAACAATCTCAACATTGAGATTCCA

>MSTRG.10.1 gene=MSTRG.10

TCATCAGACTCTTCCGCAACCAATACTTCTACCCTTCAGAAGCTCCCTATCAAAGTAGGAATCTTTTATA

>MSTRG.10.2 gene=MSTRG.10

TTCTACCCTTCAGAAGCTCCCTATCAAAGACAAATCTACAGGTCATGTGACTAAAGA

And gene Id is like this:

MSTRG.8.1       gene=MSTRG.8

MSTRG.10.1      gene=MSTRG.10

MSTRG.10.2   gene=MSTRG.10

Could you please help How I can extract sequences for these gene ids from fasta file.

If I trim header of both file then I can able extract, but I need the same header in my fasta files.

Thanks

rna-seq
• 2,228 views • link
updated by GenoMax GenoMax • written by Bioinfonext Bioinfonext

it's a frequently asked question, please search on this site.

• 0 views • link
written by shenwei356 shenwei356

2 answers

seqkit

seqkit grep -n -f ids.txt seqs.fa
• 0 views • link
written by shenwei356 shenwei356

I had answered a very similar question on the site yesterday. : C: How to remove sequences from a fasta file based on ID list? The question there was to remove sequences but can also be used in this case with a minor modification of the command line.

nabiyogesh : It is tempting to get an immediate answer by posting a question the moment you encounter it but you should spend some time doing an effort on your part as suggested by @shenwei356. It would help you find other interesting things as you look through the search results trying to find one you can use.

• 0 views • link
written by GenoMax GenoMax

yes, I will surely try to improve myself.

• 0 views • link
written by Bioinfonext Bioinfonext

Log in to answer this question.

More posts like this