script to Extract longest isoform from stringTie assembly

I have done genome guided assembly using StringTie. In the output fasta header contain: Isoform name and then gene name.

I want extract longest sequence based on gene name.

fasta file header:

STRG.3.1 gene=STRG.3

TCTCATTATT

STRG.3.2 gene=STRG.3

TCTCATTATTGTCTT

Both isoforms belongs to same gene STRG3.

I want to extract the longest isofrom.

Thanks

rna-seq

• 3,358 views • link

written 9.4 years ago by Bioinfonext

Please search Biostars (using a google search). It will save you having to ask these types of questions: How to extract the longest isoform from multi fasta file

• 0 views • link

written 9.4 years ago by GenoMax

I don't think this said link solved the problem based on some feedback I have seen on it

• 0 views • link

written 5.5 years ago by Enhancer •

0 answers

No answers yet.

More posts like this

How to correctly report exon number for CRISPR-Cas9 knockout when genes have multiple isoforms?
written 12 months ago by jakob.vanek •

Hi everyone, I'm working on CRISPR-Cas9 knockouts of several SLC transporters in order to study their roles in Glioblastoma. Since these genes have multiple isoforms, …
Confusion about StringTie
written 2.1 years ago by DGTool •

Hi, I had some confusion about StringTie. This is very similar/identical to my previous post on this, but I haven't been able to get much …
Extract the longest isoform from transcripts.fasta (rnaSPAdes output)
written 4.4 years ago by poecile.pal •

Good afternoon, I have fasta file `transcripts.fasta` (output of rnaSPAdes). It looks like this: >NODE_1_length_180_cov_13085.239743_g0_i0 CCTTTTTATTTCTCATCAAATGAATGGCATCTTCTTCTGGAAACCCTAGCTATTCTTAGC ATGATATTGGGGAATCTCATTGCTATGACTCAAACAAGCATGAAACGTATGCTTGCATAT TCGTCCATAGGTCAAATCGGATATGTAATTATTGGAATAATTGTTGGAGACTCAAATGAT >NODE_2_length_40_cov_5904.526310_g0_i1 AAAATTGCCGTGAGCAAACATATTAATGACGAGGAACGCT etc Here `g` is gene …
How to select the best isoform for a differential expressed gene in Trinity?
written 6.1 years ago by upendrakumar.devisetty

Hi, I have followed Trinity guidelines and assembled a denovo assembly as well as used that assembly as a reference to quantify the reads using …
StringTie to GFF3
written 6.9 years ago by Ric

Hi, I ran StringTie and converted its results to GFF3 with the following commands: > gffread -E stringtie_merged.gtf -o- > stringtie_merged.gff3 > sed -i.bak 's|transcript|mRNA|g' …
Percentage of RNA-seq reads in exonic, intronic, intergenic and splice junction regions
written 8.2 years ago by blooming.daisy333 •

Dear all, how could I know proportion of different genomic features for my RNA sequence data? like I want to know that what %age of …
running BUSCO on all isoforms or longest isoform per gene?
written 8.3 years ago by Farbod

Hi Biostars, In order to assess the completeness of de novo transcriptome assembly, I have used [BUSCO_v3][1]. As my assembly belongs to a fish I …
Help regarding RNA-seq STRINGTIE pipeline and output
written 9.1 years ago by pixie@bioinfo

Hello, I have started working on RNA-seq data. I have samples at 0th hr (control, 2 replicates ), and 4 other time points, each with …
Genome guided assembly using hisat2 and StringTie
written 9.5 years ago by Bioinfonext

I map pair end reads to genome using Hisat2 and sam file was sort and converted in bam file. After that I used this command …
Genome guided assembly using hisat2 and StingTie
written 9.5 years ago by Bioinfonext

I map pair end reads to genome using Hisat2 and sam file was sort and converted in bam file. After that I used this command …