Hello!
I'm trying to use ABySS 1.9.0 to assemble set of genomic paired end reads. I'm doing this on my university's HPC with parallel processing. In my PBS script, I use:
abyss-pe name=abyss_test1 k=63 in='SRR960028_1.fastq SRR960028_2.fastq' v=-v
Unfortunately, ABySS terminates quite quickly after commencing assembly, and the error message I get is:
SRR960028_1.fastq:745672: error: sequence and quality must be the same length near
TGGGGACGGCAAGTATCACAGGTGACCCACTCACTGTTTCACCTCTCACCCTAATATGACCGTGTCTACAAGAAGTCAGTCAGCTGTTTCTGTTCCCCAGTGAGAGAGCAA$
CCCFFFFFHHHHHGHIIIIIIIDHHIIIIIIIIIIIIIGIEIIIIIIII
make: * [abyss_test1-1.fa] Error 1
When I open the other file, I get:
/usr/local/openmpi/1.8.4-gcc/bin/mpirun -np 4 ABYSS-P -k63 -q3 -v --coverage-hist=coverage.hist -s $
ABySS 1.9.0
ABYSS-P -k63 -q3 -v --coverage-hist=coverage.hist -s abyss_test1-bubbles.fa -o abyss_test1-1.fa SRR96$
Running on 4 processors
0: Running on host hpc088
1: Running on host hpc088
2: Running on host hpc088
3: Running on host hpc088
0: Reading 'SRR960028_1.fastq'...
1: Reading 'SRR960028_2.fastq'...
1: Read 100000 reads. 1: Hash load: 3609195 / 268435456 = 0.0134 using 447 MB
0: Read 100000 reads. 0: Hash load: 3898410 / 268435456 = 0.0145 using 469 MB
1: Read 200000 reads. 1: Hash load: 7004611 / 268435456 = 0.0261 using 646 MB
Primary job terminated normally, but 1 process returned
a non-zero exit code.. Per user-direction, the job has been aborted.
mpirun detected that one or more processes exited with non-zero status, thus causing
the job to be terminated. The first process to do so was:
Process name: [[12781,1],0]
Exit code: 1
Does anyone know what this error means and how I can fix it?