Also: If possible, please generate the log with the verbose option turned on, by adding the argument "v=-v" to the abyss-pe command line.
Hi guys,
I've a problem with mpirun and abyss :(
I've tried to assemble test reads in abyss directory:
mpirun -np 3 abyss-pe contigs clean name=test mp="" j=3 k=20 in='test-data/reads1.fastq test-data/reads2.fastq'
And I got output file ".fa", ".hist" ... But also an error :
-------------------------------------------------------
**Primary job terminated normally, but 1 process returned
a non-zero exit code**.. Per user-direction, the job has been aborted.
-------------------------------------------------------
mpirun detected that one or more processes exited with non-zero status, thus causing
the job to be terminated. The first process to do so was:
Process name: [[25897,1],1]
** Exit code: 2**
-------------------------------------------------------*
In that example I got outputs but with my own data I haven't got any even if I can see in the log make: *** [mappedR.fa] Completed.
Advance thanks,
Siva
1 answer
Hi Siva,
Just a note: The second way you tried to run abyss-pe (without the mpirun prefix) is the correct way, i.e.:
$ abyss-pe contigs clean name=test mp="" j=3 k=20 in='test-data/reads1.fastq test-data/reads2.fastq'
The mp="" part is probably not needed.
Your abyss-pe command looks fine. Unfortunately, the output you have provided does not provide any indication about what is causing the error. Can you please post the full log of your job to a github gist?
Hi Benv,
Actually I haven't got more informations, I've tried with verbose mode and with my real data and have this file.
ps: I use mp="" to avoid other assembly like scaff or unitigs, I just want to have contigs.
I think I've maybe found the error:
error: sequence and quality must be the same length near
ANCGTTTTCTCGGTCGACATGGAGGTAAACAAAGGAACACTAGATCCGAAGATCGGATGGTCTTGCATATTATTAAAGGGTGTTAACAAGTACGAATACAA
@#1==DDAFFFD=EFFB1CGEEFECFFGIIIIIEGII?DFECEEFDEAFEEII;?A1([M::main_bam2fq] discarded 8840174 singletons
make: *** [mappedR_XRQrefSF099_SEPE-1.fa] Erreur 1
Log in to answer this question.
Even without mpirun i got that: "make: *** [mappedR_XRQrefSF099_SEPE-1.fa] Processus arrete"
I've got 105G data (fastq file)