This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Outgroup in DNA Alignment File (Nexus) (Network 5.0)

Hi everyone,

I'm essentially trying to avoid having to pay for additional software to work with the Network 5 phylogenetic software by converting my fasta alignment files to nexus files to create phylogenetic networks. I know how to do this, but what I would like to also do is to create an outgroup root sequence defined by the reference or the ancestor of all of the sequences in the alignment. According to the site's manual, the outgroup sequence must be incorporated into the alignment and named ROOT. I've tried modifying my nexus file to include the reference sequence as 'ROOT' rather than '1', but to no avail. (Of note, my sequences are just labeled 1, 2, 3, etc.). I find it relatively useless to have to buy the DNA Alignment software that comes with the Network 5 program, especially because I'd rather convert my many alignment files into nexus files on bash. My nexus file looks as such:

 #NEXUS

begin taxa;
dimensions ntax=1546 nchar=249;
format datatype=dna gap= -;
matrix

ROOT           CAGACATAGTCATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAGGACAGCTGGACTGTCAATGACATACAGA
2              CAGACATAGTCATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAGGACAGCTGGACTGTCAATGACATACAGA
3              CAGACATAGTCATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAGGACAGCTGGACTGTCAATGACATACAGA
4              CAGACATAGTCATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAGGACAGCTGGACTGTCAATGACATACAGA
...
...
...
;
end;

The ellipses are not part of the nexus file. They are just there to indicate that the sequences continue until sequence #1546.

If anyone has experiences with the Network 5 software or with how to do this, any input would be more than helpful. Let me know if you have any questions.

Thanks!!!!

nexus dna alignment outgroup root network

0 answers

No answers yet.

Log in to answer this question.