This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to add some text to a sequence name

Hi all!

I have a fasta file with the following sequence names:

>ITSPF14_7020;size=17;
TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCTTCGACGGCTGCTGCTGCGTGGCGGGCCCTATCACTGGCGAGCGT
TTGGGTCCCTCTCGGGGGAACTGAGCTAGTAGCCTCTCTTTTAAACCCATTCTGT..............

>ITSPF14_733;size=110;
TCGGAGTAAAATCTCGACGGCTGCTGCTGCGTGGCGGGCCCTATCACTGGCGAGCGT
TTGGGTCCCTCTCGGGGGAACTGAGCTAGTAGCCTCTCTTTTAAACCCATTCTGT...............

And I would like to add a label after the sequence name that already has, without removing it:

>ITSPF14_7020;size=17; DQ071354_1_Phytophthora_cactorum_strain_Shakuyaku1_1_beta_tubulin_gene_partial_cds

I have an excel file that relates each sequence ID (ITSPF14_7020) with their correspondent label

(DQ071354_1_Phytophthora_cactorum_strain_Shakuyaku1_1_beta_tubulin_gene_partial_cds)

Does anyone know how can I do this directly with a script ?? (and save me lot of time if I have to do it manually!)

Thanks a lot for your help!

Alexandra

sequence next-gen
• 2,267 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by alexandrapuertolas • alexandrapuertolas

*linearize the fasta, * use awk to create a new column containing the accession number with awk

awk -F '[>;]' '{printf("%s\t%s\n",$2,$0);}'

  • sort on first column *extract the accession number from the 2nd file and sort
  • join both files using linux 'join'
  • use awk to convert back to fasta.

A little search in biostars.org will allow you to find numerous examples for each steps...

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

0 answers

No answers yet.

Log in to answer this question.

More posts like this