Problem using MIRZA (miRNA target prediction tool)
Hello,
I am trying to use the MIRZA miRNA target prediction tool. NB: So far, I am only dealing with the basic MIRZA tool, and not any of its extensions such as MIRZA-G.
The problem that I am having is that the tool asks me to provide miRNA expression data but it does not instruct me what units of expression would be appropriate (e.g. FPKM, TPM or some other unit).
The README say the following:
[miRNA FILE FORMATS]
miRNA epression files should be in this format:
name[tab|space|multiple spaces]expression level
examples:
hsa-miR-19b 1749716.66654086
hsa-miR-7 1363730.98809087
miRNA sequence files should be in this format:
>name
sequence
example:
>hsa-miR-19b
UGUGCAAAUCCAUGCAAAACU
miRNA sequences must have a length of al least 21 nucleotides. If longer,
the sequence will be trimmed. If shorter, it will be discarded.
I have looked through the rest of the documentation and scanned through the associated paper (Khorshid et al. 2013) and I can't seem to find any more information on this. I was just wondering if anyone here knew?
Thanks!
• 1,927 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Come to think of it - I don't think the software has a usage statement in the documentation. So even if I knew more about the expression data that they want - I am still not sure that I would know how to run the tool