Hello,

I am trying to use the MIRZA miRNA target prediction tool. NB: So far, I am only dealing with the basic MIRZA tool, and not any of its extensions such as MIRZA-G.

The problem that I am having is that the tool asks me to provide miRNA expression data but it does not instruct me what units of expression would be appropriate (e.g. FPKM, TPM or some other unit).

The README say the following:

[miRNA FILE FORMATS]

    miRNA epression files should be in this format:
    name[tab|space|multiple spaces]expression level

    examples:
    hsa-miR-19b     1749716.66654086
    hsa-miR-7   1363730.98809087


    miRNA sequence files should be in this format:
    >name
    sequence
    example:
    >hsa-miR-19b
    UGUGCAAAUCCAUGCAAAACU

    miRNA sequences must have a length of al least 21 nucleotides. If longer,
    the sequence will be trimmed. If shorter, it will be discarded.

I have looked through the rest of the documentation and scanned through the associated paper (Khorshid et al. 2013) and I can't seem to find any more information on this. I was just wondering if anyone here knew?

Thanks!