This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Replace one number in the header of a fasta file

Hi everybody! I am pretty new in the bioinformatic field. I hope you can help me in this matter.

I am working with a fasta file with the following header format

>r2044088.2 |SOURCES={KEY=a0ea3476...,fw,2795082-2795162}|ERRORS={8:G,40:C}|SOURCE_1="FN869568.1 Halomonas elongata DSM 2581, complete genome" (a0ea3476c9d169a3045db6ff30c679db40e694f8)
TGCGGTCAGCGTCAAGTCGAGCAGCACGCCGCGCAGCACCCCATCCTTGTCGTCCAGCGACAGGT

>r2044089.2 |SOURCES={KEY=a0ea3476...,fw,2675676-2675756}|ERRORS={}|SOURCE_1="FN869568.1 Halomonas elongata DSM 2581, complete genome" (a0ea3476c9d169a3045db6ff30c679db40e694f8)
TACTTGGGAAGCGCTGGGAGCCAATGCAACCCCCATGGCATGGACTGAAGTCTACACCGCCCTCC

What I would like to do is to change slightly the header of each read entry in the following way using a python script: 

>r2044088.1 |SOURCES={KEY=a0ea3476...,fw,2795082-2795162}|ERRORS={8:G,40:C}|SOURCE_1="FN869568.1 Halomonas elongata DSM 2581, complete genome" (a0ea3476c9d169a3045db6ff30c679db40e694f8)
TGCGGTCAGCGTCAAGTCGAGCAGCACGCCGCGCAGCACCCCATCCTTGTCGTCCAGCGACAGGT

>r2044089.1 |SOURCES={KEY=a0ea3476...,fw,2675676-2675756}|ERRORS={}|SOURCE_1="FN869568.1 Halomonas elongata DSM 2581, complete genome" (a0ea3476c9d169a3045db6ff30c679db40e694f8)
TACTTGGGAAGCGCTGGGAGCCAATGCAACCCCCATGGCATGGACTGAAGTCTACACCGCCCTCC

Any idea?

Thanks a lot in advance

Bea

sequence
• 1,982 views • link
updated by WouterDeCoster WouterDeCoster • written by beacamara • beacamara

2 answers

That's hard to see what's changed. And wrapping a fasta record with " is weird.

It seems that you want change the version number , e.g., from r2044088.2 to r2044088.1.

Use seqkit:

seqkit replace -p "^(.+?)\.2" -r "\$1.1"   seqs.fa > new_seqs.fa
• 0 views • link
written by shenwei356 shenwei356

Thank you so much shenwei356 for your quick reply. I tried to paste the read entries as they appear in my fasta file but I do not it did not show the symbol ">". That's why I introduced " at the beginning and at the end of the read entries.

As you have mentioned, what I am trying to do is to change the version number. Thank you very much. I will try with your suggestion

• 0 views • link
written by beacamara • beacamara

I've edited your post using code formatting to better display the fasta, with the 101010 button.

• 0 views • link
written by WouterDeCoster WouterDeCoster 
sed 's/^\(>r[0-9]*\.\)2/\11/' in.fasta > out.fasta
• 0 views • link
written by kloetzl kloetzl

Thank you so much. I will try also this option

• 0 views • link
written by beacamara • beacamara

Log in to answer this question.

More posts like this