This is a test version of Biostars. For the public version, visit https://www.biostars.org.
rename Fasta file headings for use in MIRA

Hi all,

I was wondering if anyone could help me with renaming the header lines on my FASTA files?

I am using a simulated paired end metagenome. The data currently looks like:

>r1.1 |SOURCES={KEY=bf97e692...,bw,559392-559472}|ERRORS={}|SOURCE_1="CP007128.1 Gemmatimonadetes bacterium KBS708, complete genome" (bf97e6923cd410b05af0dc7641aa6e2651e19392)
GTCGCTGCAGGGGCGCGACTCGGCGCGCGTGCGCGACTCGGCGCGCGTGCGCGACTTCGCGCTCT
ACGGCGAGACGACGG

>r1.2 |SOURCES={KEY=bf97e692...,fw,558357-558437}|ERRORS={}|SOURCE_1="CP007128.1 Gemmatimonadetes bacterium KBS708, complete genome" (bf97e6923cd410b05af0dc7641aa6e2651e19392)
GAGGGCGGCTTCCACCCCGGCACCGGCCTGGCCGCCGATCGCCTCGTCGGCATGACGAAGCTCGC
CGGCGAGTGCCGTAC

>r2.1 |SOURCES={KEY=bf97e692...,bw,4893168-4893248}|ERRORS={}|SOURCE_1="CP007128.1 Gemmatimonadetes bacterium KBS708, complete genome" (bf97e6923cd410b05af0dc7641aa6e2651e19392)
TGGAACAGCTCGTCGCGGGCTTCCTCGTAGGGCGTCGGGGTCGCGACAGCATCCCGTCGTCCGCG
GTTGTTATTGCCGTG

>r2.2 |SOURCES={KEY=bf97e692...,fw,4892115-4892195}|ERRORS={76:T}|SOURCE_1="CP007128.1 Gemmatimonadetes bacterium KBS708, complete genome" (bf97e6923cd410b05af0dc7641aa6e2651e19392)
ACTAGATTGACGACGAA*

Where >r1.1 and .r1.2 are a set of paired end reads. In order to run MIRA, i need to rename the header lines into a more conventional format, i.e. >r1/1 and >r1/2.

Does anyone know how I can do this and apply it to my whole FASTA files, so that I have reads numbered : 1/1, 1/2, 2/1, 2/2, 3/1, 3/2 and so on...

Thanks for your help!

Maisie

sequencing next-gen assembly
• 1,943 views • link
updated by venu venu • written by mn1154 • mn1154

I guess you can do this easily with sed. Do you want to delete the remaining parts? e.g.

SOURCES={KEY=bf97e692...,fw,558357-558437}|ERRORS={}|SOURCE_1="CP007128.1 Gemmatimonadetes bacterium KBS708, complete genome" (bf97e6923cd410b05af0dc7641aa6e2651e19392)

• 2 views • link
written by Dataman Dataman

1 answer 

sed 's/\./\//' foo.fa > out.fa

You might have searched this forum for the similar threads. As of now here is the answer. But next time please show us what you have tried, so that we can fix the bugs in your own solution.

• 1 views • link
written by venu venu

Log in to answer this question.

More posts like this

No similar posts found.