This is a test version of Biostars. For the public version, visit https://www.biostars.org.
SAM validation error

Command

picard-tools-1.118/MarkDuplicates.jar I=file.Aligned.sortedByCoord.bam O=file_out.bam METRICS_FILE=file_out.metrics

Error Message

Exception in thread "main" htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Record 801397832, Read name K00135:24:H3V7TBBXX:1:1101:13078:1332, Mate Alignment start (1651771652) must be <= reference sequence length (59128983) on reference chr19

file.Aligned.sortedByCoord.bam was created by STAR.

Has anyone else encountered a similar error? If so, what was the fix? Thanks!

software error
• 7,903 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by fire_water fire_water

What happens if you samtools view file.Aligned.sortedByCoord.bam chr19 | grep K00135:24:H3V7TBBXX:1:1101:13078:1332?

What was the STAR command that created this (it's probably in the BAM header)?

What version of STAR is this?

• 0 views • link
written by Devon Ryan Devon Ryan

The SAMtools command returns:

"[main_samview] random alignment retrieval only works for indexed BAM or CRAM files."

STAR command in BAM header:

@PG ID:STAR PN:STAR VN:STAR_2.5.1b  CL:STAR_2.5.1   --runThreadN 16   --genomeDir /Human/Hg19/   --readFilesIn file_R1_val_1.fq.gz   file_R2_val_2.fq.gz      --readFilesCommand zcat      --outSAMtype BAM   SortedByCoordinate   
@CO user command line: STAR_2.5.1 --runThreadN 16 --genomeDir /Human/Hg19/ --readFilesIn file_R1_val_1.fq.gz   file_R2_val_2.fq.gz --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate

STAR version 2.5.1b

• 0 views • link
written by fire_water fire_water

Index the file and then try the samtools command again.

• 0 views • link
written by Devon Ryan Devon Ryan

Results:

K00135:24:H3V7TBBXX:1:1101:13078:1332   73  chr19   18876676    255 151M    *   0   0   TGAGAGGATCACTTGAGCCCAGGGGGTGGAGGCTGCAGTGAGCCATGATCACACCACTGCACTCTACCCTGGGAGACAGAGTGAGACTCTGTTTCAAAAAAAAAGAAAAAACTCAAGAGGTTAGCTTTTGATTTTTCAATTTGCTGTATTT <AA-FFAJF<FAFAFJJJJFJJJJFFJ-7F<-FJJJJJJJJFJJJAFJJFJFJ7-F<--7F-7--<<A77---FFJAFAF<<-<AFFA-<A7FAJJJFJJJJJJAFAAFAJF-AFAAJF7-77A----7-7-7<<FFAF-77<<7-7---< NH:i:1  HI:i:1  AS:i:149    nM:i:0
• 0 views • link
written by fire_water fire_water

If that still happens in the most recent version of picard then it's a bug in it.

• 0 views • link
written by Devon Ryan Devon Ryan

1 answer 

picard-tools-1.118/MarkDuplicates.jar

first : the version of picard you're using is just too old.

second: try to run MarkDuplicate with VALIDATION_STRINGENCY=LENIENT

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Upgraded to picard-2.8.2 and re-ran using VALIDATION_STRINGENCY=LENIENT, as recommended above. The job failed after ~7 hours, created a 68 GB BAM, 13 MB BAI, and a 200 MB log file.

The log contains a ton of "Ignoring SAM validation error" messages. Below is the last few lines of the log:

Ignoring SAM validation error: ERROR: Record 805313152, Read name K00135:43:H3VC2BBXX:2:2228:1681:49107, Mate Alignment start (1916272743) must be <= reference sequence length (90354753) on reference chr16
INFO    2017-01-27 17:56:07     MarkDuplicates  Before output close freeMemory: 18524841008; totalMemory: 18696110080; maxMemory: 22487236608
INFO    2017-01-27 17:56:10     MarkDuplicates  After output close freeMemory: 18524838000; totalMemory: 18696110080; maxMemory: 22487236608
[Fri Jan 27 17:56:10 EST 2017] picard.sam.markduplicates.MarkDuplicates done. Elapsed time: 398.98 minutes.
Runtime.totalMemory()=18696110080

real    399m0.405s
user    384m57.886s
sys     9m45.964s

[Fri Jan 27 17:56:11 EST 2017] picard.sam.BuildBamIndex INPUT=dedup_CB1_valstr.bam    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json
[Fri Jan 27 17:56:11 EST 2017] Executing as me@comp205t on Linux 2.6.32-642.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_101-b13; Picard version: 2.8.2-SNAPSHOT
[Fri Jan 27 18:29:42 EST 2017] picard.sam.BuildBamIndex done. Elapsed time: 33.51 minutes.
Runtime.totalMemory()=2044723200
To get help, see http://broadinstitute.github.io/picard/index.html#GettingHelp
Exception in thread "main" htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Record 801397832, Read name K00135:24:H3V7TBBXX:1:1101:13078:1332, Mate Alignment start (1651771652) must be <= reference sequence length (59128983) on reference chr19
        at htsjdk.samtools.SAMUtils.processValidationErrors(SAMUtils.java:448)
        at htsjdk.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:665)
        at htsjdk.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:650)
        at htsjdk.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:620)
        at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:569)
        at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:543)
        at htsjdk.samtools.BAMIndexer.createIndex(BAMIndexer.java:305)
        at htsjdk.samtools.BAMIndexer.createIndex(BAMIndexer.java:289)
        at picard.sam.BuildBamIndex.doWork(BuildBamIndex.java:147)
        at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:205)
        at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:94)
        at picard.cmdline.PicardCommandLine.main(PicardCommandLine.java:104)
• 0 views • link
written by fire_water fire_water

Furthermore, the program used here is not MarkDuplicate but BuildBamIndex (???)

    at picard.sam.BuildBamIndex.doWork(BuildBamIndex.java:147)
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

The commands are ran in this order:

java -jar picard-2.8.2.jar MarkDuplicates I=file.Aligned.sortedByCoord.bam O=file.out.bam M=file.metrics VALIDATION_STRINGENCY=LENIENT

java -jar picard-2.8.2.jar BuildBamIndex I=file.out.bam

Thank you for your continued help :)

• 0 views • link
written by fire_water fire_water

you said:

 and re-ran using VALIDATION_STRINGENCY=LENIENT,

...

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Command updated above (accidentally copied the old command from an old SLURM script). Thanks.

• 0 views • link
written by fire_water fire_water

but you didn't use VALIDATION_STRINGENCY=LENIENT with BuildBamIndex ...

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Re-ran MarkDuplicates then BuildBamIndex using VALIDATION_STRINGENCY=LENIENT and the job completed without errors this time! However, a 400 MB log file was created with 2 million lines similar to the following:

Ignoring SAM validation error: ERROR: Record 801397832, Read name K00135:24:H3V7TBBXX:1:1101:13078:1332, Mate Alignment start (1651771652) must be <= reference sequence length (59128983) on reference chr19

Should I be concerned? If not, can these messages be turned off so that such a large log isn't created ? Thanks.

• 0 views • link
written by fire_water fire_water

Log in to answer this question.

More posts like this