This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error while doing indexing of fasta file using SAMTOOL faidx

I am trying to do indexing of a CDS fasta file, I am geeting error:

[root@psgl BWA]# /home/yog/software/samtools-1.3.1/samtools faidx Radish_cds.fasta
[fai_build_core] different line length in sequence 'Rs276960'.
Could not build fai index Radish_cds.fasta.fai

Please suggest how I can resolve it.

Yogesh

rna-seq
• 7,849 views • link
updated by Ram Ram • written by Bioinfonext Bioinfonext

Did you take a look at that sequence in question? It may be just a case of a broken fasta record.

• 0 views • link
written by GenoMax GenoMax

2 answers

The error looks pretty clear - Your sequences may be of unequal length in different lines. Why an indexer does not auto-normalize (or at least provide an option for it), I do not know.

Try using NormalizeFasta on the file before indexing it.

• 0 views • link
written by Ram Ram

SeqKit

seqkit seq -w 70 s.fa > s2.fa
• 0 views • link
written by shenwei356 shenwei356

Log in to answer this question.

More posts like this
  • Error in reference fasta file when indexing with samtools
    written by Saran • Saran
    Hello, I made the following reference fasta file (amplicons.fa) with only two sequences: ``` >BALV3loop GTACAAGACCCAACAACAATACAAGAAAAAGTATAAATATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCACATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAATAAGATAGTTATAAAATTAAGAGAACAATTTGGGAATAAAACAATAGTCTTTAAGCACTCCTCAGGAGGGGACCCAGAAATTG >NL4-3V3loop GTACAAGACCCAACAACAATACAAGAAAAAGTATCCGTATCCAGAGGGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATGCCACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCCTCAGGAGGGGACCCAGAAATTG ``` I am trying to index the …
  • Errors when using samtools faidx and bgzip for indexing human reference genome
    written by hello_bioinf • hello_bioinf
    Hello, I know there are previous questions on this topic, but they have not helped my problem. I am trying to use samtools faidx to …
  • Error with samtools faidx...Different line length in sequence
    written by oars oars
    I've tried making a "fai" file using the below command: samtools faidx genome.fa But I get an error: [E::fai_build_core] Different line length in sequence '(null)' …
  • Multiple sam to bam followed by raw read count
    written by Bioinfonext Bioinfonext
    I have multiple sam file like this: sam file location: /data/SNU_work/Analysis/mapped/mapped samtool location: /home/yog/software/samtools-1.3.1/samtools 218_9W_Pa2.sam 218_9W_Pa1.sam 216_7W_Co1.sam 216_7W_Ca2.sam 216_7W_Ca1.sam I converting them one by one …
  • ERROR: while running fastqc on a fastq file
    written by Bioinfonext Bioinfonext
    I am getting error while running fastqc on one of the pair end fastq file: /home/yog/software/FastQC/fastqc -t 8 -o /data/Analysis/data_new/qc/ /data/Analysis/data_new/AS_0_R2_001.fastq Failed to process /data/Analysis/data_new/AS_0_R2.fastq …
  • Error building database in snpEff
    written by Bioinfonext Bioinfonext
    I am getting some error while building database in SnpEff: java -jar /home/yog/software/snpEff/snpEff.jar build -gtf22 -v genome 00:00:00 SnpEff version SnpEff 4.3k (build 2017-03-29 17:16), …
  • To extract unmapped pair end reads
    written by Bioinfonext Bioinfonext
    Actually I map raw reads to CDS of Draft genome where all genes CDS is not present. I used below cammand lines for pair end …
  • Raw Read count from bam file
    written by Bioinfonext Bioinfonext
    I mapped pair end reads to CDS transcripts using BWA. If I do sorting of bam fine by not using -n flag than its worting: …
  • Error while running BWA
    written by Bioinfonext Bioinfonext
    I build Indexing using this cammand: /home/yog/software/bwa-0.7.15/bwa index Rs_1.0.cds.fasta After that I am running BWA cammand for mapping raw reads to indexed transcripts using this …
  • GMAP: a genomic mapping and alignment program for mRNA and EST sequences
    written by Bioinfonext Bioinfonext
    Deal all, I installed GMAP, and build indexing of draft genome using gmap_build by using this cammand. /home/yog/software/gmap-2016-11-07/util/gmap_build -D /home/yog/database/ -d custard_genome Custard_1.0.chromosomes.fix.fasta Now want …