Can you send this question as an email to genome@soe.ucsc.edu? That way our whole team can see the question and has the opportunity to answer.
Thanks ChrisL from the UCSC Genome Browser
Hello,
I am writing concerning the following UCSC utility (binary file): http://hgdownload.cse.ucsc.edu/admin/exe/
================================================================
======== mafsInRegion ====================================
================================================================
mafsInRegion - Extract MAFS in a genomic region
usage:
mafsInRegion regions.bed out.maf|outDir in.maf(s)
options:
-outDir - output separate files named by bed name field to outDir
-keepInitialGaps - keep alignment columns at the beginning and of a block that are gapped in all species
I have been playing with this executable a little bit, and have came across some odd behaviour:
If I pass a BED file with one record to mafsInRegion - we have success, and the expected behaviour is exhibited i.e. a region is extracted from the input MAF file to an output file according to the given genomic co-ordinates - e.g.
chr1 1233 1244 Transcript_1 (mafsInRegion processing succeeds)
However, If I pass a different BED file to mafsInRegion, this time with the same BED record, but this time with an additional BED record including either the same start or end co-ordinate of the preceding BED record, then mafsInRegion will fail - and apart from header information, the output file is empty:
chr1 1233 1244 Transcript_1 (mafsInRegion processing succeeds)
chr1 1233 1245 Transcript_2 (mafsInRegion processing fails)
chr1 1244 1245 Transcript_3 (mafsInRegion processing fails)
So my question is this:
Thank you
Hello,
I have come across the same odd behaviour using mafsInRegion and from what I have noticed, the coordinates do not seem to matter, it's a problem with the number of lines in the bed file.
Running the program with a single line bed file returns the expected result. Running it with more than 5 lines will fetch the wrong region in some cases and will return an empty file for others.
Here's an example of a line that works when in a file by itself :
chr2 179456038 179462464 CATP00000883767.1 2 +
I get :
##maf version=1 scoring=autoMZ.v1
a score=0.000000
s hg19.chr2 179456038 66 + 243199373 ATGGTAAGTACTGATGAGAAGTTGTCTGTTTCAACTGTGTAGTGCTCATCGGTTTTAATCTCACTC
s panTro2.chr2b 183626670 66 + 248603653 ATGGTAAGTACTGATGAGAAGTTGTCTGTTTCAACTGTGTAGTGCTCATCGGTTTTAATCTCACTC
q panTro2.chr2b 999999999999999999999999999999999999999999999999999999999999999999
i panTro2.chr2b C 0 C 0
s gorGor1.Supercontig_0273903 2142 66 - 2212
.....
which is the correct output.
when run in a file that contains 13 other lines and looks like this :
chr2 179406992 179407028 CATP00000004513.1 1 +
chr2 179436036 179440708 CATP00002698154.1 1 +
chr2 179442318 179442540 CATP00002345870.1 1 +
chr2 179464336 179464426 CATP00001176733.1 2 +
chr2 179500339 179500447 CATP00002315182.1 1 +
chr2 179474319 179474529 CATP00002157734.1 1 +
chr2 179629093 179638047 CATP00002900465.1 1 +
chr2 179479248 179479527 CATP00000210653.1 2 +
chr2 179436036 179462326 CATP00002016444.1 2 +
chr2 179439945 179440820 CATP00002345871.1 1 +
chr2 179404308 179404431 CATP00000332098.1 1 +
chr2 179482495 179482699 CATP00001007021.1 2 +
chr2 179412405 179412684 CATP00002348243.1 2 +
chr2 179456038 179462464 CATP00000883767.1 2 +
the coordinates get messed up and I get this :
##maf version=1 scoring=autoMZ.v1
a score=0.000000
s hg19.chr2 179462327 96 + 243199373 AGACGCCTTGATGGCTCCTCTGGCAGTTCTTGATGACCATGG----ATGAGCTAATGGCTGTGGTCTCAATGGTGGCTTCTTGAGGTAAGGTTCTTTCAT
s panTro2.chr2b 183632906 96 + 248603653 AGACGCCTTGATGGCTCCTCTGGCAGTTCTTGATGACCATGG----ATGAGCTAATGGCTGTGGTCTCAATGGTGGCTTCTTGAGGTAAGGTTCTTTCAT
q panTro2.chr2b 999999999999999999999999999999999999999999----999999999999999999999999999999999999999999999999999999
......
Notice how the start coordinates have changed in hg19.chr2 in the second case
When running the same multi-line file, the output file CATP00002345870.1.maf (corresponding to the bed file's first line) contains only :
##maf version=1 scoring=autoMZ.v1
However if I run the relevant line :
chr2 179406992 179407028 CATP00000004513.1 1 +
by itself, I get the correct output :
##maf version=1 scoring=autoMZ.v1
a score=0.000000
s hg19.chr2 179406992 36 + 243199373 ATGCTGCTGCGACACTCTATGACCTCAGACTGCAAG
s anoCar1.scaffold_385 468376 36 + 1396552 ATTCTGCTTTTGCATTCTACGATTTCAGACTGTAGG
q anoCar1.scaffold_385 999999999999999999999999999999999999
i anoCar1.scaffold_385 I 8 C 0
s taeGut1.chr7 17984185 36 + 39844632 ATTCTGCTCTTGCATTCTATAATTTCAGACTGCAGG
q taeGut1.chr7 999999999999999999999999999999999999
.....
I should specify that I am searching in the hg19/GRCh37 46-way MAF alignments downloaded from http://hgdownload.cse.ucsc.edu/goldenPath/hg19/multiz46way/
This feels like a bug to me, although I really hope it isn't. Any ideas?
Thanks
Can you send this question as an email to genome@soe.ucsc.edu? That way our whole team can see the question and has the opportunity to answer.
Thanks ChrisL from the UCSC Genome Browser
Hi Chris,
The question has been sent to genome@soe.ucsc.edu as well.
Thank you, Nikos
Hello, Thomas.
Thank you for questions about our utility "mafsInRegion".
Unfortunately, I was unable to replicate this issue. My input MAF file was hg38/multiz7way.maf and a BED file that contained the following two lines:
chr21 31659621 31668831 uc002ypa.4.1
chr21 31659621 31668931 uc002ypa.4
As you can see both transcripts start at the same position, but have slightly different end positions. My output using this file was a file that contained MAF lines just as I would have expected:
##maf version=1 scoring=blastz
a score=0.000000
s hg38.chr21 31659621 547 + 46709983 GTTTGGGGCCAGAGTGGGCGAGGCGCGGAGGT-------CTGGCCTATAAAGTAGTCGCGGAGACGGGGTGCTG---GTTTGCGTCGTAGTCTCCTGCAGCG-------TCTGGGGTTTC------
...
Perhaps you can provide more information about what MAF files you are using with your example BED lines? I also attempted to replicate the issue using the BED lines that you provided and I didn't have any luck getting any meaningful output. I made a file with just a line for "transcript_1" and then I made another with both "transcript_1" and "transcript_2". In both cases, I used the hg38/multiz7way.maf MAF file I referenced before and I only got the output:
##maf version=1 scoring=blastz
Which would seem to indicate that there were no alignments in the MAF at this position? (I can also confirm this by looking at the Genome Browser for hg38 at this position with the 7-way multiz track active: https://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=mspeir&hgS_otherUserSessionName=hg38_biostars_226762.)
If you are still having issues, it would be helpful if you could post them to our Google Groups forum: https://groups.google.com/a/soe.ucsc.edu/forum/#!forum/genome-mirror, that way our whole team can see the question and help with an answer.
Thanks,
Matthew from the UCSC Genome Browser
Thank you Matthew - sorry, I have only just seen your message. I will look into this and get back to you.
Cheers, Thomas
Log in to answer this question.