This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Convert DNA Sequences into numerical vectors for R / Weka classification using NB / SVM

I would like to use machine learning techniques such as Naive Bayes and SVM in Weka to identify species using DNA Sequence data. The Issue is that I have to convert the DNA sequences into numerical vectors.

MY sequences are like this:

------------------------------------------------G ------------------------------------------GGAGATG ------------------------------------------GGAGATG ------------------------------------------GGAGATG TTATTAATTCGAGCAGAATTAGGAAATCCTGGATCTTTAATTGGTGATG ----------------------------------------------ATG CTATTAATTCGAGCTGAGCTAAGCCAGCCCGGGGCTCTGCTCGGAGATG -----------------------TCAACCTGGGGCCCTACTCGGAGACG ----TAATCCGAGCAGAATTAAGCCAACCTGGCGCCCTACTAGGGGATG CTATTAATTCGAGCTGAGCTAAGCCAGCCTGGGGCTCTGCTCGGAGATG TTATTAATTCGTTTTGAGTTAGGCACTGTTGGAGTTTTATTAG---ATA

How can I do this? Any suggestion of other programs for doing ML with DNA sequences besides Weka?

sequence machine learning classification

1 answer

I don't know anything about how to use Weka, I just know it exists. However, dr. Google showed this result: https://sourceforge.net/projects/bioweka/

It might be interesting!

That program does not work. No manual, nor examples and very user complicated.

Log in to answer this question.