This is a test version of Biostars. For the public version, visit https://www.biostars.org.
what is multiple base substitution

Hi guys, I am using mutation data in ICGC. There is a mutation type named "multiple base substitution". Please refer to an example at https://dcc.icgc.org/mutations/MU63993950

In a nutshell, this record says

at chr21:g.10848413,

AATCAAAAGGAATGGAATGGAATTTAATTGAATGGAATCTAAAGGAATG

mutates to

ACTCGAAAGGAGTGGAATGGAATCTAAAGGAAAT

The length of the sequence differs before and after mutation. I am wondering why substitution changes the length of sequence. Besides, why the mutated site is a single base, i.e.chr21:g.10848413 ?

So, can anybody help to explain what "multiple base substitution" is? Thanks a lot.

Arvin

genome
• 2,447 views • link
updated by Devon Ryan Devon Ryan • written by solo7773 solo7773

1 answer

The full mutation name is rather longer than just chr21:g.10848413, it's chr21:g.10848413AATCAAAAGGAATGGAATGGAATTTAATTGAATGGAATCTAAAGGAATG>ACTCGAAAGGAGTGGAATGGAATCTAAAGGAAAT. Whether one wants to refer to this as a "multiple base substitution" or just an indel is mostly a judgement call, but in the later case it's a bit more obvious why the size changes.

• 0 views • link
written by Devon Ryan Devon Ryan

Thanks Devon. Then it's confusing why ICGC uses such a name. I searched in google and google scholar but cannot find details about this.

• 0 views • link
written by solo7773 solo7773

I agree that their naming is a bit odd. What they're trying to convey is that there are stretches similar to the reference with bases occasionally missing or different. I suppose just calling this an indel would lose that distinction.

• 0 views • link
written by Devon Ryan Devon Ryan

Log in to answer this question.

More posts like this