This is a test version of Biostars. For the public version, visit https://www.biostars.org.
RNA Seq - Tophat GFF errror

Hi All,

I can't figure out the answer to this problem for the life of me.

[2016-09-20 12:12:38] Building transcriptome data files.. [2016-09-20 12:12:39] Building Bowtie index from NC_007793.fa [FAILED] Error: Couldn't build bowtie index with err = 1

This is the tophat error I am getting.

This is my reference fasta:

gi|87159884|ref|NC_007793.1| ACTACTGCTCAATTTTTTTACTTTTATCGATTAAAGATAGAAATACACGATGCGAGCAATCAAATTTCAT AACATCACCATGAGTTTGGTCCGAAGCATGAGTGTTTACAATGTTCGAACACCTTATACAGTTCTTATAC ATACTTTATAAATTATTTCCCAAACTGTTTTGATACACTCACTAACAGATACTCTATAGAAGGAAAAGTT ATCCACTTATGCACATTTATAGTTTTCAGAATTGTGGATAATTAGAAATTACACACAAAGTTATACTAT

This is my reference gff

  1. gi|87159884|ref|NC_007793.1| RefSeq Coding gene 544 1905 . + . name=dnaA;product="chromosomal replication initiation protein"

Tophat works fine when I just use the reference file but when I try to align with the GTF it errors out.

Thanks in advance.

rna-seq annotations staph aureus tophat
• 2,191 views • link
written by niznet84 • niznet84

Can you also provide your tophat commands, one without GTF that works and one with GTF that doesn't work?

• 1 views • link
written by Satyajeet Khare Satyajeet Khare

1 answer

Found the solution, ran tophat/htseqcount separately and changed 'Coding gene' -> exon, and set the htseq parameter --idattr=name.

• 1 views • link
written by niznet84 • niznet84

Log in to answer this question.

More posts like this