This is a test version of Biostars. For the public version, visit https://www.biostars.org.
is there a DB for illumina adaptors/contamination?

Hi,

trying to figure out of this repetitive seq in my data is a contamination or not: tggggaaatcgcaggggtcagcacatc-cggagtgcaatggataagcctcg any ideas where I can find a DB? (It is not automatically recognized as an illumina adaptor)

Thanks

sequencing rna-seq
• 2,104 views • link
updated by WouterDeCoster WouterDeCoster • written by blur blur

4 answers

you can find find all possible adapters and contaminants from Illumina in the "Configuration" folder of FastQC tool (also create a reverse complement of all those adapter sequences and check )

• 1 views • link
written by SJ Basu • SJ Basu

What about NCBI blast db?

• 1 views • link
written by Benn Benn

Maybe previous posts Finding Adapters For Illumina Reads and blogs help

• 1 views • link
written by dago dago

According to blast, both are snRNA/ncRNA

• 1 views • link
written by WouterDeCoster WouterDeCoster

Log in to answer this question.

More posts like this