This is a test version of Biostars. For the public version, visit https://www.biostars.org.
what does PCR primer seq "5-gtttcttTCTGGAAGAGACTTAGATGG- 3(reverse)" mean?

This is a PCR primer sequence for the human genome, but a blat on UCSC genome browser with either "gtttcttTCTGGAAGAGACTTAGATGG" or "TCTGGAAGAGACTTAGATGG" yielded no match.

Also, why the leading sequence "gtttctt" is in lower cases?

alignment genome blast sequencing
• 4,019 views • link
written by dr.genetics dr.genetics

1 answer

But a blast search brings up this hit to

Query  1     TCTGGAAGAGACTTAGATGG  20
             ||||||||||||||||||||
Sbjct  3474  TCTGGAAGAGACTTAGATGG  3455

Homo sapiens V1-vascular vasopressin receptor AVPR1A gene, promoter region and partial cds

GTTTCTT overhang gives restriction enzymes a supporting substrate around restriction site (so says a google search).

• 1 views • link
written by GenoMax GenoMax

The GTTTCTT (and similar overhangs) are called a 'pigtail'. The purpose of this is to assure non-template adenylation. In the case you use these primers for capillary electrophoresis to determine size of e.g. repetitive fragments, that could be important. A bit more info in the original publication: http://www.ncbi.nlm.nih.gov/pubmed/8780871

• 1 views • link
written by WouterDeCoster WouterDeCoster

True that this primer is used to measure the length of a repetitive seq using capillary electrophoresis in the literature. Is the gtttctt removed by restriction enzyme after PCR amplification?

Thanks a lot!

• 1 views • link
written by dr.genetics dr.genetics

No, the tail is just kept on the amplicon. There is no need to remove it, you just need to take the slightly increased length into account.

• 1 views • link
written by WouterDeCoster WouterDeCoster

Got it. Technically you don't need to remove it, but analytically, when people say the amplified sequence is, say, 327bp long, what does the 327bp include? Are both primers including the pigtail all included?

• 1 views • link
written by dr.genetics dr.genetics

I would assume that it includes primers and tags and as such reflects the amplicon size as how you would see it on agarose gel or capillary electrophoresis.

• 1 views • link
written by WouterDeCoster WouterDeCoster

Great! Thanks a lot for the help!

• 1 views • link
written by dr.genetics dr.genetics

OK, very helpful. Blast actually brings up dozens of matches. :) The other primer is unique in the genome, though.

Thanks a lot for your help.

• 1 views • link
written by dr.genetics dr.genetics

Log in to answer this question.

More posts like this