This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to use a fastq file from paired library layout

Hi biostars!

I want to assemble some reads from real dataset like http://sra.dnanexus.com/studies/ERP000108/runs. However, I am confused with the description of Accession ERR011087. It says, library layout: paired. I do not know what this "paired" means.

The first 24 lines of ERR011087.fastq is

@ERR011087.1 I330_1_FC30JM6AAXX:4:1:0:199 length=88 TTCANATATGGAAAAACAGGGAGCGGAAATCACGTTACTTGCGTATCATCGGAAAAGGCAGGCTGTCCATGCTCCAACCGGTTAATGA +ERR011087.1 I330_1_FC30JM6AAXX:4:1:0:199 length=88 IIII"9I;III<+<-45CI13;-=93+046/0<1:-06>4.2+4:I86III0.863;GA@7I:5./2$62110='0(2(0$+++&+( @ERR011087.2 I330_1_FC30JM6AAXX:4:1:0:242 length=88 ACAANCTTCTCAATCTCGGTCTTTTTCTTGGGGAACTCCTTGGTAATAGAACTTGGAACACAGTCCTTGGATGAATACCGTTCTTTTG +ERR011087.2 I330_1_FC30JM6AAXX:4:1:0:242 length=88 @?;+"IIIIIIF+FII@9<16I<<bd+b6+4>1&&4%-08)/$$+III4.I@III3CIE:,@+04>8799H015./21/@/51791 @ERR011087.3 I330_1_FC30JM6AAXX:4:1:0:394 length=88 ATCANTTTCACTCAAACCATTAATAACATCTACCTGGTTCTTCAGGCTTCGATTCGTTTAAGGGTGATCAAGAGGCAATCATCAGAAA +ERR011087.3 I330_1_FC30JM6AAXX:4:1:0:394 length=88 2BI;"IIIIIIIG:8CCB<e?i7i c1ei4i)4&lt;7;212+f5="" ;6iiif&lt;7gi8c?i8'70="7@=$&lt;7+2.-+,4&amp;/*.24,&amp;4*&amp;*" @err011087.4="" i330_1_fc30jm6aaxx:4:1:0:438="" length="88" accancaatatcggtaacagtacccgtcttggaacccttaacctgaagattgatggctttggcagctttggcaactggcgttgctttg="" +err011087.4="" i330_1_fc30jm6aaxx:4:1:0:438="" length="88" &lt;2="">."I7IIII8;=8)(CI;/II81):2>548,+7(&:6?&+-06+DIGCBII6-GIB9<i7i= 911?+4+21;-)43:.20---+-="" @err011087.5="" i330_1_fc30jm6aaxx:4:1:0:740="" length="88" actgntctttggcatggctcatgagcattcccatcttgtttgtcagccagataggtgccaacaaccaccgtcttgaagtttctaccat="" +err011087.5="" i330_1_fc30jm6aaxx:4:1:0:740="" length="88" 3iii"iiiiiiiii="">;IIIF5I>3;45=IB3=):2<d6;ah0:*5h6ibiiic9iii:ii1d=282>3;-11ID:.0,H<,6-'5/7 @ERR011087.6 I330_1_FC30JM6AAXX:4:1:0:753 length=88 ATGANCGCTATGCATGATGATACGACTGTTTTTGTCGCGCGCCTCAGCGTGTGCACCTTTACGCCCAGATATGACGCGACAGCGTTGG +ERR011087.6 I330_1_FC30JM6AAXX:4:1:0:753 length=88 IIII"IIII3I=I6I=5I18I+;:+4959A&0>&,++(&(-(,90IIIAB;IA;IDIIIF;@G56:+9=?034,0+210'+204+&

I did not see anything suggests there exists some kind of pair in the file. Does this file only contain single-end reads or pair-end reads? If it contains pair-end reads, how can I figure out which two reads are in one pair?

Thanks.

next-gen
• 7,234 views • link
updated by qingxiangg • qingxiangg • written by thustar • thustar

2 answers

To answer you first question:

'Library layout: Paired' simply means that it's a paired end sequence run. If you visit ENA (which in my opinion is simpler to use for raw read downloads) for ERR011087, this is what you find http://www.ebi.ac.uk/ena/data/view/ERR011087&display=html. You can see that there are two fastq files listed here.

I'm guessing that you retrieved yours through ncbi sra with fastq dump? You have to be careful here and actually specify that you want both pairs of sequences extracted, as I believe the default is for it to not to...

• 1 views • link
written by Jenez Jenez

Yes, I use fastq-dump to convert sra file to fastq file.

Do you mean that if I use fastq-dump directly, I will have a mistake?

• 1 views • link
written by thustar • thustar

Depends on how you used fastq-dump. For paired end illumina files you would want to use --split-files option to get the two PE files.

• 1 views • link
written by GenoMax GenoMax

Simple answer to your question,

ERR011088 is the pair file of ERR011087

ERR011090 is the pair file of ERR011089

Check the design description, pair-end files will share the same sample, i.e., Solexa sequencing of MetaHit individual MH0001 random pair end library for ERR011088, ERR011087

• 1 views • link
written by qingxiangg • qingxiangg

oh, really? I do not agree with you.

Could you please show me the link to the description? I did not notice that.

• 1 views • link
written by thustar • thustar

Log in to answer this question.

More posts like this
  • how to get a new fastq file according to their barcodes?
    written by ruiyan_hou • ruiyan_hou
    hi, everybody, I have a question to ask. Hope to get your help and thank you. I have a set scRNA-seq data (10×). It includes …
  • Keep the paired reads whose length less than 400,000 bp
    written by ek699 • ek699
    Hi, I am very new to bioinformatics and I am struggling with filtering out my bam file from STAR alignment. Previously, I filtered out the …
  • Strange length of merged paired-end sequencing reads after using BBmerge
    written by bioplanet • bioplanet
    Hi all, I encountered a strange problem when using BBmerge to align paired-end sequencing data. My construct that got amplified is 430nts long and each …
  • Cutadapt not trimming adapters in PE mode
    written by tlorin tlorin
    Hello all, Please apologies if this is a trivial question regarding cutadapt but it is the first time I am running this program. I have …
  • How to split paired end SRA file into 2 correct fastq files
    written by thustar • thustar
    Hello Biostars! In my project, I have to convert several [SRA files][1] to fastq files. These SRA files are paired end. I read a previous …
  • PE read flag 69 and 137 meaning
    written by epigene epigene
    I'm very confused with the meaning of flag 69 and 137. From the explain flag tool https://broadinstitute.github.io/picard/explain-flags.html flag 69 (1+4+64) means: read paired read unmapped …
  • searching reads with a certain sequence in fastq file
    written by sumithrasank75 sumithrasank75
    I have a file say master.fastq which looks like : ``` @M00990:202:000000000-ADM27:1:1101:21678:1536 2:N:0:291 CCTTTTACCGACCCGCTCTTTCTCTCCTACGCTTATTTCCGTCTACCCTTCTCTTCACTCGCTATTTCTATTCTTAAAACTATCTTAATGTTCTGCCTTTGCTCTTTTCTTTTTTCTATAACCTCTCTACAGCCAACTCACCCATCTCCTTCCCTGCTACGCTATTCCTCTGTTAGTTTTTCTTCATCATACTTTTCTCATCTCACACTACCTTTGCACTTCTTCCTTTCCACGTCCCCTTTCTCCTACC + -----,,6;6,@+8++6+,,,<C5@,,,,,,+8,,;,,<,,,,,,,;,,;,,,<C,,,;,,8,,8CC,C,,,5,C,,,,99,+,+4,,,3,,9,,6,@<,,,,,,,9,,,,,,,4),,0**,,5),,5**,)59*0),,*)5,)))*,9,3,0++))5D:)))))5;+;+0)*;+*6++++),******3**50,6,+++**,0*,,31)88*0*1*5*1)0*:*7>C;3,035:0)))8).*2**.*:) @M00990:202:000000000-ADM27:1:1101:22685:1539 2:N:0:291 CTTATCACCGACTCTCTCCTTCTCTTCCAAGTTTATTTCCGACTCCCCTTATCTTCACTTGCTATTTCTATTCTTAAAACTATCTCGACCTTTCACCTTTCCCTCTTTCCTTCTTTTCTCTCCTTCTACACTCCCACCCACTCTTACTTCTTTCTTGTCACCGTTTCCATATTATACTTTCTTCTCTTACATAATTTTCTTCCTGCAAACTATTTAAGCAATCTCTTTCTTTCACCCCTTTTATCTCGCC + -----,,<;67@+B,,6,,,,;C5@,,,,,66<,,6,,<,,,66,,;,66,,;;C,,,;,4<,,<CC6C,;,,,;,,6,:,6?A9=,,+++2,5,,,9<?D,,,,,:C?,@,@,,5,?*3*,9**,,0**,*)93))4+))19*0**,,52,56+**5*03*)3)))42+2***5*+=3+,*4*2****,**2*,3,+++*0,50,,**5*****0****)5)***0**,,***3*)0)))3***0*))) ``` I want only …
  • How can I BLAST each sequence in a FASTA-file against all the other sequences in the same file?
    written by driliwyr • driliwyr
    I'm looking for a way to BLAST each sequence in a file, protein sequences in FASTA format, against all the other sequences in the same …
  • Can these fusion predictions by tophat be trusted
    written by Dataminer Dataminer
    Hi, I have got these results from tophat-fusion: ``` chr15-chr17 74317267 38506035 ff 1 13 1 7 43 33 10.000000 @ 13 26 38 51 …
  • Fastq With Format Errors
    written by Geparada Geparada
    <p>I'm aligning RNA-seq paired-end <a href="http://hgdownload-test.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCaltechRnaSeq/releaseLatest/">reads</a> from ENCODE project, but some FASTQ has reads with Phred error lines longer than their sequence, what makes my …