Bowtie2 mapping algorithm about multiseed process

I know bowtie2 separate the 'reads' into several 'seed's before mapping as shown below. My question is that do they map all the 'seed's and then combine the results of all the 'seed's to find the best position for the 'read'? If not, how?

The mannual of bowtie2 to do not explain it clearly and their paper associated neither.

Read: TAGCTACGCTCTACGCTATCATGCATAAAC

Seed 1 fw: TAGCTACGCT(pos:1-10)

Seed 1 rc: AGCGTAGCTA

Seed 2 fw: CGCTCTACGC(pos:7-16)

Seed 2 rc: GCGTAGAGCG

Seed 3 fw: ACGCTATCAT(pos:13-22)

Seed 3 rc: ATGATAGCGT

Seed 4 fw: TCATGCATAA(pos:19-28)

Seed 4 rc: TTATGCATGA

rna-seq alignment bowtie2

• 2,748 views • link

updated 10.1 years ago by Devon Ryan

• written 10.1 years ago by --panda-- •

1 answer

Have a look at figure S1 from the bowtie2 paper. In short, the seeds are prioritized and extended (if possible) into full alignments. Those are then ranked to find a best alignment, which is reported with a MAPQ given according to the other alignments.

• 1 views • link

written 10.1 years ago by Devon Ryan

Thanks! That's helpful

• 1 views • link

written 10.0 years ago by --panda-- •

More posts like this

Understanding bowtie2 for short reference sequences
written 3.9 years ago by Sina •

Hello, I have been trying to understand how bowtie2 performs when you align a sequence against a short reference sequence (say a MID, adapter or …
no input BAM records found in ./tophat_out_SRR5481725/tmp/right_kept_reads.m2g_um.candidates15.bam …
written 7.7 years ago by ALI Hkz •

Hi here is my commands and unfortunately i give this error massage in tophat2! tophat2 -p 16 --keep-fasta-order -o ./tophat_out_${NAME}\ --read-mismatches 4\ --read-gap-length 4\ --read-edit-dist …
How is the 2nd best hit found in bwa-mem
written 8.6 years ago by IP

Hi biostars! I have a question about how is the 2nd best hit found in bwa-mem for calculating the mapping quality. From the [bwa paper][1], …
Tophat Reporting output tracks, run out of memory, how to solve?
written 8.7 years ago by zoukai3412085 •

running log as follow: [2017-11-27 14:14:14] Beginning TopHat run (v2.1.1) ----------------------------------------------- [2017-11-27 14:14:14] Checking for Bowtie Bowtie version: 2.3.3.1 [2017-11-27 14:14:14] Checking for Bowtie index …
bowtie2 - Can anybody explain the mismatches in the alignment if no mismatches are allowed in the s…
written 9.1 years ago by shim •

Hi, I'm doing an alignment to multiple relatively short targets that are quite similar. I'm using bowtie2 for its local-alignment capabilities (and since I'm used …
How to calculate Mapping Quality in sequencing data?
written 10.0 years ago by --panda-- •

I'm curious about how the mapping quality is calculated in those sequence mappers. So far I haven't found a really explicit explanation about this. For …
Tophat runs through without errors but no read mapped
written 10.1 years ago by jrxu.bioinf •

Hello, I am a new user of tophat. The version in use is v2.1.1 (tophat2). I used default parameters except for --no-coverage-search to save time. …
Using the ABySS pipeline to scaffold a DISCOVAR de novo assembly
written 10.7 years ago by dbrowne.up •

Hi all, I have a DISCOVAR de novo assembly that was made with 2x250 bp paired end reads with a fragment size of ~800. Since …
Error while running Tophat 2.0.11
written 12.0 years ago by subodh •

Hi everyone, I have a problem in running tophat 2.0.11 with a 50 bp paired end illumina RNA reads. I have used following command: ``` …
Tophat Error When "Reporting Output Tracks"
written 13.7 years ago by Pierre Lindenbaum

<p>I'm learning tophat . here is the Makefile I'm using:</p> <pre><code>include tools.mk REF=./chr22 REF.bowtie=$(foreach S,1.bt2 2.bt2 3.bt2 4.bt2 rev.1.bt2 rev.2.bt2, $(addsuffix .$S,$(REF)) ) GTF=Homo_sapiens.GRCh37.69.gtf export …